Transcript asmbl_28817

Sequence
Transcript Sequence for observation asmbl_28817 of TGE0004682:
GTAAAACGTTAATATGTTGGTTATAGAAGAGACATAATTTCCACTCATTTTACCATGGTCACTCATATCCACAGTTAAAACTTGGCTGACTTTTTAAAACTGTTTTCCAGGCATTGATCACTCAGACTCGAGCCAAACAGGCAGCGACCATGAGCGAAGTGGAGTGGAGAGGGAGAGCGGTCCCGGTGAAGATCGACAGAGTGCGGATCTTTTTGTTGGGGTTGGCCGATAACGAAGCAGCCATTGCCCAGGCTGAGAGCGAAGAAACCAAGGAACGTCTGTTTGAGTCTGTGCTCAGCGAGTGTCGGGACGCCATCCAGGCCGTGCGGGAGGAGCTCAAGCCCGATCAGAAGCAGAGAGATTACACCCTCGAGGGAGAGTCGGGGAAGGTGTCTAATCTTCAGTACCTGCACAGCTACCTGACCTACATCAAGCTGTCAACGGCGATCAGGCGGAACGAGAACATGGCCAAAGGTCTGCAGAGGGCCCTTCTGCAGCAGCAGCCGGAAGACGACAGCAAACGCTCCCCCCGGCCGCAGGACCTCATCCGGCTCTACGACATCATCCTGCAGAATCTGGTGGAATTGCTCCAGCTTCCTGGCTTAGAGGAGGACAGAGCCTTCCAGAAAGAGATAGGCCTCAAGACCCTGGTGTTCAAGGCTTACAGGTGTTTTTTCATTGCTCAGTCCTACGTGTTGGTGAAGAAGTGGAGCGAAGCCCTCGTCCTGTATGACAGAGTCCTAAAATATGCAAATGAAGTGAATTCTGATGCTGGGGCCTTCAAGAATAGCCTGAAAGACCTGCCTGACGTGCAAGAGCTTATCACGCAAGTGAGGTCAGAAAAGTGCTCTCTGCAGGCGGCGGCGATCCTGGATGCAAGTGACTCCCACCAAACAGAGACTTCCTCTCAAGTCAAGGAGAATAAGCCCCTGGTTGAGCGGTTTGAGACCTTCTGCCTGGACCCTTCCCTCGTCACTAAGCAGGCCAACCTCGTGCACTTCCCTCCGGGATTCCAGCCCATCCCTTGCAAGCCTTTGTTCTTTGACCTGGCGCTCAACCACGTGGCTTTCCCACCCCTCGAGGACAAGTTGGAGCAGAAGACCAAGAGTGGGCTCACCGGGTACATCAAGGGCATCTTTGGATTCAGGAGCTAACCACTCTTTTCCTTGGGGGCAGGGGGTAATTCTGACTCGGTCTGTATTGTGAGAAAACTCTAGCAAGTCTGTGATATTAAATCCAGGTCTGCGTTGGCCCAGGGCGGGAGTGTAACATCCTCAGCCCTGCGTTCCTATGTCTGTGTGTGTGCGCTCATGTTCTTAACCGGTGTGCCAGGAGGGCACCCTGTTGTCTTCTGGTGGATGTGTGCGGGGTCCCTCTGTCCATACCTCCCGGAGGAGGGCCGCTGCCATCTGGGCCCGTGCGAGCTGTGATTGTTTACCTCTGGTCCGTAACGTGTTCGGGAGGAGGTCCACTCCAGGCACCGCGAGCGCTCGGAAAGCTTTGCTGCGTTTCTTCAGTGCTGTGGACTTAAAACACACTCCTCCTCGCTGTGAGCATCCAGGACCCTTTGGAAAGTTTGTTCGTGACTAGGAAACACTGGCAACGTCCCCCCAGAACGACAGTCAGCCTCCCCCCTTCACTGCCAAGTGAAAGTTCAGAAGTTTCAGAACAAGCAAAGAGCTCTATTTTTAGAAGAAATATGTTATACTCAGAATTGATGAAAACAAATCTTATATTAAAAGGCAAAGATGCTGGA