Transcript asmbl_8200

Sequence
Transcript Sequence for observation asmbl_8200 of TGE0014537:
GAGGCCCGGGGCCGCGCGGCCTTCCAGAGGCCGGGCGTGTCCGAGGTGACTAACAGGTAGCAGGACTAGAACAGCCGACGACCAGAAGTGGAAGTGAGCCCGGGGCGGAGGTGAGGAGAGGCCACAGCTCGCCTGCGCTGTCAGCGGGGTTGCACTACGCATGAGCAGTTGAGCGGTGACGAGGTGACGCTGGGAGCGTGGGCCGCGACTCTCGCGGATCCGGTTCCGCCCTCCCTCTTGCTGCCGACCCTCCGGGGCTAGCGCCCGAGTTCCCTTTCCCAGAGTCCTCTGCGCCGTGAAGAAGCGGCTCCCGGGGACCGGGGGCATTTTGCGTTGGCTGGAGCCGGAGTAACAAGATGGCGGCGTCGGCGGAGTGACAGGGGTCCCTCCGGGAGGGAGCCGGCAGCAGTGGTGGCAGCGGGATCGCCGCCCTAACTCACCGCGCCCCTTTTCCAGCCCGCGACGTCGCCGCGAAAGCGAGGCAGCAGCGGCCGCCCAGACACAAGTGGCCCAGCCTGGTAACCGCGAGGACCCCTCACACACTGCGGCCTGGCGAGAAGAAACCTGCCTGAGCGGCGGTGATCAGGTTCCCCTCGGCTGATTCCGGGCCTGGTAACGCCGAGCCAACGCTTTCAGCTTCCTGCCGCCCTCCTCCGCAGCCTTGCTCCGGGGACGAGCCCAGAGGCCTCCGTCCTCCTCTCAGAGGTGTCGGGGCTCGGCCCCAGCCCCCGTCTGCGCCTCTCAGGATGGCGAGCAGCAGCGGCTCCAAAGCCGAATTCATTGTCGGAGGGAAATATAAACTGGTACGGAAGATCGGGTCTGGCTCCTTCGGGGACATTTACCTGGCGATCAACATCACCAATGGCGAGGAAGTGGCAGTGAAGCTAGAATCTCAGAAGGCCAGGCATCCCCAGTTGCTGTACGAGAGCAAACTCTATAAAATTCTTCAGGGTGGGGTTGGCATCCCCCACATACGGTGGTATGGTCAGGAAAAAGACTACAATGTGCTAGTCATGGATCTTCTTGGACCCAGCCTTGAAGACCTCTTCAATTTCTGTTCGAGAAGGTTCACAATGAAAACTGTACTTATGTTAGCTGACCAGATGATCAGTAGAATTGAATATGTGCATACAAAGAATTTTATACACAGAGACATTAAACCAGATAACTTCCTAATGGGTATTGGGCGTCACTGTAATAAGTTATTCCTTATTGATTTTGGTTTGGCCAAAAAGTACAGAGACAACAGGACAAGGCAACACATACCATACAGAGAAGATAAAAATCTCACTGGCACTGCCCGATATGCTAGCATCAATGCACATCTTGGTATTGAACAGAGTCGCCGAGATGACATGGAATCATTAGGATATGTTTTGATGTATTTTAATAGAACCAGCCTGCCATGGCAAGGACTAAAGGCTGCAACAAAGAAACAAAAATATGAAAAGATTAGTGAAAAGAAGATGTCCACTCCTGTTGAAGTTTTATGTAAGGGGTTTCCTGCAGAATTTGCCATGTACTTAAACTATTGTCGTGGGCTGCGCTTTGAGGAAGCCCCGGATTACATGTATCTGAGGCAGCTATTCCGCATTCTTTTCAGGACCCTGAACCACCAATATGACTACACATTTGATTGGACAATGTTAAAGCAGAAAGCAGCACAGCAGGCAGCCTCTTCAAGTGGGCAGGGTCAGCAGGCCCAAACCCCCACAGGCAAGCAAACTGACAAAACCAAGAGTAACATGAAAGGAACAAAGGAATCCATTTCTTATTTTAACTGTTGTTGCAGTGAAGATGGGTTTTTGGACTTTTAGAAGCCAGGAGATACCACCTAAAGTTCAAGATAAAAACCAAGGACTAATGCACACTGGAGAGAAGAATGCTTGCTTAGCACTTGAAGACCGAATGTCGAAATCATGCTGAATGCTTCTATTGTGATTTTTAACATCACTGACATCTTAGGATAATTCACTGGAGAAACATTGATCCCTGGGTGTGGAGTATCATAGCACACTGGACGATCTGAAGAATAAAATCTGGATTCGGCTGCTGTATTCTGCCAGGAATATCGTTAGGCTAGCCTTTAACCAGTCCGTAAACAATTGTAAATCATTAGTTGACTCAGCAATTCCTCAAATATCAGATTAAAGATGAACAGATAAAATTCTTACCTAGGTATAATTCTTATCCCTACACAACAGATTTCTACTATTTTGACTGCCAGTGTAACTTATATTTCCACATTTTAGTT