Transcript asmbl_8199

Sequence
Transcript Sequence for observation asmbl_8199 of TGE0017768:
GAGGCCCGGGGCCGCGCGGCCTTCCAGAGGCCGGGCGTGTCCGAGGTGACTAACAGGTAGCAGGACTAGAACAGCCGACGACCAGAAGTGGAAGTGAGCCCGGGGCGGAGGTGAGGAGAGGCCACAGCTCGCCTGCGCTGTCAGCGGGGTTGCACTACGCATGAGCAGTTGAGCGGTGACGAGGTGACGCTGGGAGCGTGGGCCGCGACTCTCGCGGATCCGGTTCCGCCCTCCCTCTTGCTGCCGACCCTCCGGGGCTAGCGCCCGAGTTCCCTTTCCCAGAGTCCTCTGCGCCGTGAAGAAGCGGCTCCCGGGGACCGGGGGCATTTTGCGTTGGCTGGAGCCGGAGTAACAAGATGGCGGCGTCGGCGGAGTGACAGGGGTCCCTCCGGGAGGGAGCCGGCAGCAGTGGTGGCAGCGGGATCGCCGCCCTAACTCACCGCGCCCCTTTTCCAGCCCGCGACGTCGCCGCGAAAGCGAGGCAGCAGCGGCCGCCCAGACACAAGTGGCCCAGCCTGGTAACCGCGAGGACCCCTCACACACTGCGGCCTGGCGAGAAGAAACCTGCCTGAGCGGCGGTGATCAGGTTCCCCTCGGCTGATTCCGGGCCTGGTAACGCCGAGCCAACGCTTTCAGCTTCCTGCCGCCCTCCTCCGCAGCCTTGCTCCGGGGACGAGCCCAGAGGCCTCCGTCCTCCTCTCAGAGGTGTCGGGGCTCGGCCCCAGCCCCCGTCTGCGCCTCTCAGGATGGCGAGCAGCAGCGGCTCCAAAGCCGAATTCATTGTCGGAGGGAAATATAAACTGGTACGGAAGATCGGGTCTGGCTCCTTCGGGGACATTTACCTGGCGATCAACATCACCAATGGCGAGGAAGTGGCAGTGAAGCTAGAATCTCAGAAGGCCAGGCATCCCCAGTTGCTGTACGAGAGCAAACTCTATAAAATTCTTCAGGGTGGGGTTGGCATCCCCCACATACGGTGGTATGGTCAGGAAAAAGACTACAATGTGCTAGTCATGGATCTTCTTGGACCCAGCCTTGAAGACCTCTTCAATTTCTGTTCGAGAAGGTTCACAATGAAAACTGTACTTATGTTAGCTGACCAGATGATCAGTAGAATTGAATATGTGCATACAAAGAATTTTATACACAGAGACATTAAACCAGATAACTTCCTAATGGGTATTGGGCGTCACTGTAATAAGTGTTTAGAATCTCCAGTGGGGAAGAGGAAAAGAAGCATGACTGTTAGTACTTCTCAGGACCCATCTTTCTCAGGATTAAACCAGTTATTCCTTATTGATTTTGGTTTGGCCAAAAAGTACAGAGACAACAGGACAAGGCAACACATACCATACAGAGAAGATAAAAATCTCACTGGCACTGCCCGATATGCTAGCATCAATGCACATCTTGGTATTGAACAGAGTCGCCGAGATGACATGGAATCATTAGGATATGTTTTGATGTATTTTAATAGAACCAGCCTGCCATGGCAAGGACTAAAGGCTGCAACAAAGAAACAAAAATATGAAAAGATTAGTGAAAAGAAGATGTCCACTCCTGTTGAAGTTTTATGTAAGGGGTTTCCTGCAGAATTTGCCATGTACTTAAACTATTGTCGTGGGCTGCGCTTTGAGGAAGCCCCGGATTACATGTATCTGAGGCAGCTATTCCGCATTCTTTTCAGGACCCTGAACCACCAATATGACTACACATTTGATTGGACAATGTTAAAGCAGAAAGCAGCACAGCAGGCAGCCTCTTCAAGTGGGCAGGGTCAGCAGGCCCAAACCCCCACAGGCAAGCAAACTGACAAAACCAAGAGTAACATGAAAGGAACAAAGGAATCCATTTCTTATTTTAACTGTTGTTGCAGTGAAGATGGGTTTTTGGACTTTTAGAAGCCAGGAGATACCACCTAAAGTTCAAGATAAAAACCAAGGACTAATGCACACTGGAGAGAAGAATGCTTGCTTAGCACTTGAAGACCGAATGTCGAAATCATGCTGAATGCTTCTATTGTGATTTTTAACATCACTGACATCTTAGGATAATTCACTGGAGAAACATTGATCCCTGGGTGTGGAGTATCATAGCACACTGGACGATCTGAAGAATAAAATCTGGATTCGGCTGCTGTATTCTGCCAGGAATATCGTTAGGCTAGCCTTTAACCAGTCCGTAAACAATTGTAAATCATTAGTTGACTCAGCAATTCCTCAAATATCAGATTAAAGATGAACAGATAAAATTCTTACCTAGGTATAATTCTTATCCCTACACAACAGATTTCTACTATTTTGACTGCCAGTGTAACTTATATTTCCACATTTTAGTT