Transcript asmbl_17976

Sequence
Transcript Sequence for observation asmbl_17976 of TGE0000476:
CGCCTCTGAGCCGCGGAGGATTGTGGGAGGAGGTTGTCTCCAATTTCTCCTCCCCCTCCCGGCCAAGATGTCTGACATGGAGGATGATTTCATGTGCGATGATGAGGAGGACTACGACCTGGAATACTCTGAAGATAGTAACTCCGAGCCAAATGTGGATTTGGAAAATCAGTACTATAATTCCAAAGCATTAAAAGAAGATGACCCAAAAGCGGCATTAAGCAGTTTCCAAAAGGTTTTGGAACTTGAAGGTGAAAAAGGAGAATGGGGATTTAAAGCACTGAAACAAATGATTAAGATTAACTTCAAGTTGACAAACTTTCCAGAAATGATGAATAGATATAAGCAGCTATTGACCTATATTCGGAGTGCAGTCACAAGAAATTATTCTGAAAAATCCATTAATTCTATTCTTGATTATATCTCTACTTCTAAACAGAATTCTGATTTTTTATGTCAGATGGATTTACTGCAGGAATTCTATGAAACAACACTGGAAGCTTTGAAAGATGCTAAGAATGATAGACTGTGGTTTAAGACAAACACAAAGCTTGGAAAATTATATTTAGAACGAGAGGAATATGGAAAGCTTCAAAAAATTTTACGCCAGTTACATCAGTCGTGCCAGACTGATGATGGAGAAGATGATCTGAAAAAAGGTACACAGTTATTAGAAATATATGCTTTGGAAATTCAAATGTACACAGCACAGAAAAATAACAAAAAACTTAAAGCACTCTATGAACAGTCACTTCACATCAAGTCTGCCATCCCTCATCCACTGATTATGGGAGTTATCAGAGAATGTGGTGGTAAAATGCACTTGAGGGAAGGTGAATTTGAAAAGGCACACACTGATTTTTTTGAAGCCTTCAAGAATTATGATGAATCTGGAAGTCCAAGACGAACCACTTGCTTAAAATATTTGGTCTTAGCAAATATGCTTATGAAATCGGGAATAAATCCATTTGACTCACAGGAGGCCAAGCCGTACAAAAATGATCCAGAAATTTTAGCAATGACGAATTTAGTAAGTGCCTATCAGAATAATGACATCACTGAATTTGAAAAGATTCTAAAAACAAATCACAGCAACATCATGGATGATCCTTTCATAAGAGAACACATTGAAGAGCTTTTGCGAAACATCAGAACACAAGTGCTTATAAAATTAATTAAGCCTTACACAAGAATACATATTCCTTTTATTTCTAAGGAGTTAAACATAGATGTAGCTGATGTGGAGAGCTTGCTGGTGCAGTGCATATTGGATAACACTATTCATGGCCGAATTGATCAAGTCAACCAACTCCTTGAACTGGATCATCAGAAGAGGGGTGGTGCACGATATACTGCACTAGATAAATGGACCAACCAACTAAATTCTCTCAACCAGGCTGTAGTCAGTAAACTGGCTTAACAGAGAACAAGCTTTTACAGACGTCCTTAAGGCAACAGTGCAGAGATGTAATCCTTAAAAGAACTGGGAATGGCAAAACTACTGTCGGTTGATGTGTCCTGAAAATTATTGGAGTTATGGCAGAAGTGCTTTTTTGATCAACTGGTTTGTGTTTTGCTGCTGCATTTATCCCAAGAAAAACAGCTTTAATCTCCAGAAGAAAACCAAAATACCATGGGATTTATGCTGTATTGACATCTTGCCCTAAACGTACAACATCATAGTAATTTGTCATGGGCAACATGACCAGAGAGAAGATTTTTGTCATGATTTTAAATACACTGACACGCTACTGTTGGTTAAATTTAAACATGTTTTACCTGCAGAAATTCTCTCACAAATAACCTGCAATAACTTGAAATGCATACCCTTTTGAACACTTCCTTTTCTCATGTATAAATTAAAATGTTTGCTGCATTTTGCAAAATGTCAATTCTCTAAAAATGTGTCCGTATATTTCTGTACCTGCAGTGTAGTAAAGGTTTAGACGAAACCCCATAATTATAGTGGCATACTGTCACTTAGGTTTCAAGCAGCAAAATAAACAGTGCAGCTCAGAAATTGTAGTTTGGTTCTTGATGTGTTTTTATTACATTTGGAGTTGTTTTGTTTTTTAGTACCTTCGAAATTTCAAATTATTTTATCTTCAGTTAATGATTTTAAAAAGCCTGGGGGCAAATAAG