Transcript asmbl_28808

Sequence
Transcript Sequence for observation asmbl_28808 of TGE0004678:
CGGCGGCCTCGCCACTGGCCCTCGGGAGGCTGCGGCACGGCTCGCCCTGAGCTCCGGGTCCCACAGAGCGCGTCGCGGCCTTTCGTACGAGGAGGCTGGGCATCTTGGACCGCTCCCCTCCTCTGCCGGGTTCCTTGGCATCTTCTCCGGCCGGACCCCCGGGCCTCGCGGCCCCCTCAGTCGGCACCGTTCCCGGCTGCAGCCCCGCGCGGGCCGGCTGTAACCGCGCCGCGGGCCGGACGATGCCCAGGAAGCTGCTGCTGCTGCCCCCGCGCTCCGTGCCCTCGGCTTTCCGCGCCCCGCGAGCCAGCTCCTCCGCAAGCGCGGCCATGAACGCCGCCCGCACCGGCTACCGAGTCTTCTCGGCCAACTCCACGGCCGCCTGCACCGAGCTGGCCAAGCGCATCACCGAGCGTCTTGGTGCTGAATTGGGGAAGTCTGTGGTATATCAAGAGACCAATGGAGAAACAAGAGTTGAAATAAAAGAATCTGTTCGTGGCCAAGATATTTTCATTATACAGACAATACCCAGAGATGTGAATACAGCTGTGATGGAGTTGCTGATCATGGCTTATGCGCTGAAGACGGCCTGTGCCAGGAATATTATCGGAGTCATCCCTTATTTCCCCTACAGCAAGCAAAGCAAGATGAGGAAGAGGGGTTCCATCGTGTGCAAGCTACTAGCATCCATGCTGGCGAAAGCAGGTTTAACTCACATTATCACTATGGACCTTCATCAAAAGGAAATACAAGGCTTTTTCAGCTTTCCCGTGGACAACCTTAGAGCCTCACCTTTCCTGCTTCAGTATATCCAGGAAGAAATTCCAAATTACAGAAATGCAGTCATCGTAGCGAAGTCTCCTGATGCTGCAAAAAGGGCCCAGTCATACGCTGAGAGGCTCCGTCTGGGTCTAGCCGTGATCCACGGAGAAGCACAGTGCACAGAGCTGGATATGGACGACGGTCGTCACTCACCTCCGATGGTCAGAAATGCCACCGTCCACCCGGGCCTGGAATTGCCGTTGATGATGGCCAAAGAGAAGCCACCGATAACTGTCGTCGGAGACGTCGGAGGGAGCATCGCGATCATAGTGGATGACATCATCGACGACGTGGAAAGTTTTGTCGCTGCGGCAGAGATCCTGAAGGAGAGGGGCGCTTACAAGATCTACGTCATGGCCACTCACGGCATCCTGTCCGCAGAGGCCCCCCGCCTCATCGAGGAGTCCTCCATCGATGAGGTGGTGGTGACGAATACTGTCCCTCACGAGGTGCAGAAGCTGCAGTGTCCCAAGATAAAGACTGTGGACATCAGCCTGATTCTCTCTGAGGCCATTCGGAGAATCCACAACGGAGAGTCCATGGCGTACCTCTTCCGGAACATCACTGTGGACGACTAGCTTTCTCTGGAACTCCTGAGACGCGTGGGAGGCGGCAGCAGTGTGACGTCCGCAGCGTTTCCTTGCAGGGGACTCGGGTGGTCTCGTGCCGTTCGCTTTGTAGGAGGCTTTAAGATAGTCGAGGGGGAGACACAGCTAATGGGTAAAGGGCCTTAAACGTCTGCCCTCACCATCCCGTCCCTCAAACAGAAGTCACATTTTCCTGAAAAGAACCTGAACATCTTCTGACACTGCAAAGGCGTTAGAGGCAGAGACAGTGCTAACTCTGGTGTCCGTTCAGCTGTTTCGGCCGCAGGGAGACGTGTGTTCACGTTGAACTTGGGCGGGCAGCTGGGCGCCCCGGCTCTGTGCCTGCTGCAGTTGTCCTCTCCCTGGCCAACTGCACGTAAACCTTTTGTAGAGAACCGTGTTTTCCTCTGAGAAGCTGCTGTGCGTACAGCCTCTGAACCATAAAGCATTTAGCGTCATCCCCAGCAAGGCCCTAGATAGAGAATAAGACCCTGTCTCTCGGTGTCTGCATTGCTCTTAAATTACAAATAAAGGAATTTGTTATCTTG