Transcript asmbl_28790

Sequence
Transcript Sequence for observation asmbl_28790 of TGE0004673:
CGGCGGTGCCGGCTCCCGATTGGCCAGCGCGCGGAGGGTAAAAGTGGGCGCGCGGGAACCGGCGCGAGCTTTCGGAGCTGCGGGTGCGAGCGAGGTTTCTGTCCGGAGAGGTTCCTGGAGGTGCCATGAGCTGCGTCAACCTGCCCACGGTGCTGCCTGGCTCCCCCAGCAAGACCCGGGGGCAGATCCAGGTGATCCTCGGACCCATGTTCTCAGGAAAAAGCACGGAGCTCATGAGACGGCTCCGACGCTTCCAGATTGCCCAGTACAGGTGCTTGATGATCAAATACGCCAAAGACACGCGGTACAGCGACAGCTTCTGCACGCATGACCGAATATTTCGTCGGCTCCTAAAAGGACCGTAAGCCCTGGCTGCTGTGCCTGATGAGGTCACCCTGTCCATCCCGGCCCACCGTTGAACAGAAGCAGAGGAGAACTTTACAGTGGCCCCACTGACATCTGGTCCAGAGGGCCGGTGTCCCCCTCAAAGGCCTTCCCAGGGCGCCAGCTCCTCGATGCCCTGAGCACTCAGGGCAACCTGCGTCACCGGAACACCATGGAGGCG