Transcript asmbl_28789

Sequence
Transcript Sequence for observation asmbl_28789 of TGE0004673:
CGGCGGTGCCGGCTCCCGATTGGCCAGCGCGCGGAGGGTAAAAGTGGGCGCGCGGGAACCGGCGCGAGCTTTCGGAGCTGCGGGTGCGAGCGAGGTTTCTGTCCGGAGAGGTTCCTGGAGGTGCCATGAGCTGCGTCAACCTGCCCACGGTGCTGCCTGGCTCCCCCAGCAAGACCCGGGGGCAGATCCAGGTGATCCTCGGACCCATGTTCTCAGGAAAAAGCACGGAGCTCATGAGACGGCTCCGACGCTTCCAGATTGCCCAGTACAGGTGCTTGATGATCAAATACGCCAAAGACACGCGGTACAGCGACAGCTTCTGCACGCATGACCGAATATTTCGTCGGCTCCTAAAAGGACCGTAAGCCCTGGCTGCTGTGCCTGATGAGGTCACCCTGTCCATCCCGGCCCACCGTTGAACAGAAGCAGAGGAGAACTTTACAGTGGCCCCACTGACATCTGGTCCAGAGGGCCGGTGTCCCCCTCAAAGGCCTTCCCAGGGCGCCAGCTCCTCGATGCCCTGAGCACTCAGGGCAACCTGCGTCACCGGTAGGGGGGTGCTCAGGAGAGCTGCTCGGGCCCCTGCATCCTGGTGGCTGCTGTCCCTTGCTCACCTGCTGGCTTTCCCCGCAGGAACACCATGGAGGCGCTGCCGGCCTGCCTGCTCCGCGACGTGGCCCAGGAGGCCCTGGGCGTGACTGTCATAGGCATCGACGAAGGGCAGTTTTTCCCTGACATTGTGGAGTTCAGCGAGGCCATGGCCAACGCCGGGAAGACTGTGATTGTGGCTGCACTGGATGGAACCTTCCAGAGGAAGGCTTTCGGGACCATCCTGAACCTGGTGCCCCTGGCCGAGAGCGTGGTGAAGCTGACGGCCGTGTGCATGGAGTGCTTCCGCGAAGCCGCCTACACCAAGAGGCTGGGCATGGAGAAGGAGGTTGAGGTGATCGGAGGAGCTGACAAATACCACGCTGTGTGCCGCCTCTGCTACTTCCGAAAGGCCTCGGGTCAGCCCGACGGGCTGGACAGCAACGAGGACAAGGAGAACTGGCTGGTGCTGGGAAAGCTGGGGGAGGCCGCGGAGGCCAGGGCGGCCACGGGGGCCCGGAAGCCCCTCGCTGCGCATCAGATCCTGCAGCGCAGCCCCCCCAACTGAGGCCCCAGTGATGCCTTCCCCTCTGCATGCCCGGCGGCCTGTCAGAGGAGGAAGTCCCAGGTGGGTGAGGCTTCCTGGGCACCTGGAACTTTCTGCCATCACAGGGCCCTGCCCTGCTGGCGGTATGCGGCCCATTTCTCCCTCTGCCTGCCCACTGCCTCTCAGTTCCCTTCCCAGCTGCCGATCCGCTCAGGACCACCCCGGGCTGGAGCCGGCCACTGCCCGCACCGCTCCTTCTCCTTTGAGCTGTGGGGCAGGCCACACGCTGCTGTGACGTCAGCCCGGCTGGCTTCTTCCCCCTCTGTGGCTTTCACTGTTGAGTTTCGGTTCTCACTGGGAAGTTCAGGCGGCAGCACCTCTGGCTCAGCGCGGAGCCTCATTCCACACAAAGGATTCTGTCCCTTGGCCTGGGACAGGCTCCCAGCCGGAGGGCGGCTAGACTTGTGCCCTTTCGCTTCCCTGTGGGCTGAAAGCTCTTCCTGCTCTGGTGATGACTTTCTTGAGGCTCACAGCTTCATTCATGTGGGTGACACCTGCTGAGGCTCAGACCCCAGGGGTTTGCTAGTCTTTTATGGGGAACTGGGGGCAAGGTCCCTGATTCTTGTGGTAGAGAGTGAAATGAATACGTGACATTAAAATGCACTAGTTGGCAGGAG