Transcript asmbl_72445

Sequence
Transcript Sequence for observation asmbl_72445 of TGE0007664:
AAAAAAGTTGAGGCAGCTTTTGTTGAATGCTGTCTGTGTGGGTACACTTGCTACACCTTGAACTGTGTGTGCTAAGAGAAACAGACAGCCAGGAGTCCATGTTCATGCTGAAACTTGAAAAATCCCTCCACCTGTATTAAGGAGTTCCAAGAAAAGGAAGAAGGTAAAAGACTATGCAATTGTTTATCATCTTACAGTAATAGAACACACCAAAAAACTTTACATGACAAGGAAGGAAAGTCCCTTCACTGCTTTCAGTCAAGGTCAGTGGTGTCTATAGTGGATAGTGGAGATGGAGCAAGCATAGGATGAGATAAAGCTTAAGTCTACATCTCATGCATAGCTGTCCTTGTTTTGTCCTCGATTGTCTCTCAGACATCCGAATTAGAACTGAGGTTTGTTAACCTGGGGTCCGCATTGATTTCATATCTGTAATGATACCCTTCCATGTGATCCCTGCAGGCATCTCTGATGTTATGCATCCACTTTTTTATCCCCTTGCGGTTCAAATACAAAACCAGTAGGAAAATCGCGCCTATCAGGGCTAAAACAATACCTAGGAAGACATAAGAAGTCTGCAGGGATGGAGGGAGGATAGGATCACAGTCCAGGTCTGAGCTGTTGAGTTCCAAGAGGACCCGATTCCTCATTTTTTCAGGGAATGCACAGGTGAGCCTAGCTTTGCCCTGCACGACCTCTGTCTCCTTGAGCCAGGCCACCATGTCCACCATGTGGCAGTCGCATACCCAGGGATTGTTGTCCAGAAAGACCCTGACTTGGGGCAGGCCCTGCAACTCTGCCAGGGTGCCGTTATGAAGGACCTTGAGGGAGTTGTCCTCCAGGTGGAGGCTTTCTAGGTGTGTCAGGTTGCGGAAGGACACATAAGTCAGGCTCACCAACGAGTTGTTACGCAGGTCCAGGTGCCTAAGGGCCGGCATTTGTGCCAGTACGTCGCGGGGCAGATAGAGCAAGTGGTTGCTGGTCAGCTCCAGGCGGTGGAGCCCGCGCAGAGCCTGGCCAGCTCGCAGGGCCGCTGCCACCATACCTTCGAAGCTACGGTTCTCTCGATCGAACTCAGGAGGCAGGATGTGGTTCAGGAACAGTTCCACCAGAGGGCTGGGGGCAGAGGCGCTGGCGTTTCTGCCCGAGAAAGCGAAGGGGCTGAGGTCGTCCAGCGGGTTGTGGCTAAGGTCGAGCTGGCGCAAGCTGGGCAGTTGCTCGAAGGCGCCAGCGTGCACCTCCTTTAGGCGGCTGCCGCTGAGGTTGAGCGCGGTCAGCTCGTCCAGCGGCGGTCTGCGGGCGAAGGCGCCGGCAGGGAGCACCGCCAGCTGATCGCCGGTGAGGAAGAGGTTGCGCACATAAGGGGGCAAGTCCGCTGGCACCTCGGTCAGGTTGCGGTTAACGCACTTGACGGTGCGCGCCGCCTCGGAGCACTCGCATGGCGGGGGGCACTGGCCTGGCAGCGGGGGCTGTGCGGACACCGCGGAGGCCAGGAACTGCGCGGAGGAGGTGGAGGACGTCGCCGAGGAGGTGAGTGAGGACGAGGTGACCCAGCCCAGGAGGACCACCGCCAGCCACAGCCGAGCGTCCCCGGCGGCGGGGCCCCAGGAGCACCCCCCAGGCATCACGGCACGGGTCTCCCCGGAGCTGGGCTGGGACAGAGCCCGCTCCGAAGGCTCGGGAGCTGGGCCCGGAGAGCGCGGGTCGGCCGGAGGTGTCTAGAGAAAACTTTCCTCTCGTGGGAGGGCTCAGCAACCAGAACTTGGCTAACCCCTTGACCACCGGATGTCCTCCTCCCAGGGCCGATTCCCCCGCCCCTTCCCTCTAGAAAGTACGCACAGCGGGTGTGGACACTCAACTCCCGCTCCTCTTCCTGCCGCCGCCCCCGGGTTGCCACCTCCTCGCCTCTTTTGTTGGCGCCTTGCGCTGGATCCGCTGCAGGACCTGGGACAAGCGGGAGAGAACCGTGAGGAGCGGCAGCGGCCGCAGCTCCCCGAGTACGGAAACCGGCCTAGCCAAGCCAAGTCGTCCGCACT