Transcript asmbl_28765

Sequence
Transcript Sequence for observation asmbl_28765 of TGE0004671:
TCCGCCTTCCGCTGAGGCGCGCGCTTTGCTCTCATCCTGTTCGGGATCATGGCGGCCACGGCCACGATGGCGACCTCTGGCTCGGCGCGGAAGCGTCTGCTCAAAGAGGAAGACATGACCAAAGTGGAATTCGAGACCAGCGAGGAGGTGGACGTGACCCCCACGTTCGACACCATGGGCCTGCGGGAGGACCTGCTACGCGGCATCTACGCCTACGGATTTGAAAAACCGTCGGCAATCCAACAGCGAGCCATCAAGCAGATAATTAAAGGGCGAGATGTCATCGCACAGTCTCAGTCTGGCACAGGCAAAACTGCCACCTTCAGTATTTCCGTCCTCCAGTGTTTGGATATTCAGGTTCGTGAGACCCAGGCTTTGATTTTGGCCCCAACGAGAGAGCTGGCTGTGCAGATCCAGAAGGGCCTGCTCGCTCTGGGTGACTACATGAACGTCCAGTGTCACGCCTGCATCGGGGGCACCAACGTGGGGGAGGACATCAGGAAGCTGGACTATGGACAGCACGTGGTCGCCGGCACGCCGGGCCGTGTCTTTGATATGATTCGTCGCAGAAGTTTAAGGACACGTGCTATCAAGATGCTGGTTTTGGATGAGGCCGATGAAATGCTGAATAAAGGTTTCAAAGAGCAGATCTACGACGTGTACAGGTACCTGCCCCCGGCCACGCAGGTGGTGCTCATCAGCGCCACGCTGCCCCACGAGATCCTGGAGATGACCAACAAGTTCATGACCGACCCCATCCGCATCCTGGTGAAACGTGACGAGCTGACTCTAGAAGGCATCAAGCAGTTTTTTGTGGCGGTGGAGAGAGAAGAGTGGAAATTTGACACTTTGTGCGACCTCTACGACACGCTGACCATCACACAGGCTGTCATCTTCTGCAACACCAAAAGGAAGGTTGACTGGCTGACAGAGAAGATGAGAGAAGCCAACTTCACCGTGTCGTCGATGCATGGGGACATGCCACAGAAGGAGCGGGAGTCCATCATGAAGGAGTTCCGGTCTGGTGCCAGCCGCGTGCTCATTTCCACCGACGTCTGGGCCCGGGGGCTGGACGTCCCTCAGGTGTCCCTCATCATCAACTATGACCTGCCCAACAACAGAGAGCTGTACATCCACAGGATCGGCCGGTCGGGCCGGTACGGCCGGAAGGGCGTGGCCATCAACTTCGTAAAGAACGATGACATCCGCATCCTGCGGGACATCGAGCAGTACTACTCCACGCAGATCGACGAGATGCCCATGAACGTTGCCGACCTGATCTGAGGCGCCCGCCGGGGTCCCGCAGCCACGGGGGCCGTTCCGGGCCGGTCCTCGTTCCTGGAGTCATGTGGACTCTCCTCACAGAGTCCCCGCAGTTGGAGTCATGTGGATTCTCCTCACAGAGTGCTGGTGGTGGTAGAGGTTCTTCCTTTTCTTACTTATGTGTAAATAGCGCTTTGCTTTATGTGTTTTTCATTAAACGCTTGAAACTCTTC