Transcript asmbl_28730

Sequence
Transcript Sequence for observation asmbl_28730 of TGE0004666:
GGGTTTATAAGAGCGGGGCGGGCGGTGCGCGCTCTCGAGGCCTCGCTGTCCGGCGGCGCCAACTGAAGCGCCGCTCCCGCTGCCGACATGCTGCGCCGCGTTCTGCTCTGCCTGGCCCTGGCCGCGCTAGGTCGCGCGGGCGCCGACCCCGACGAGGAGGACCACGTCCTGGTGCTGCACAAGGGCAACTTCGAGGAGGCGCTGGCGGCCCACAAGTACCTGCTGGTGGAGTTCTATGCCCCTTGGTGCGGCCACTGCAAGGCCCTGGCCCCCGAGTATGCCAAAGCGGCTGGAAAACTGAAGGCGGAAGGTTCCGAGATCAGACTGGCCAAGGTAGACGCCACGGAGGAGTCTGACCTGGCCCAGCAGTATGGCGTCCGCGGCTACCCTACGATCAAGTTCTTCAAGAATGGAGACACGGCTTCCCCCAGGGAGTATACAGCTGGCAGAGAAGCCGACGACATTGTGAACTGGCTGAAGAAACGCACGGGCCCCGCTGCCACCACACTGCCCGACGAGGCCGCCACAGAGGCCTTGGTGGAGTCCAGCGAGGTGACGGTCATCGGCTTCTTCAAGGACGTGGAGTCGGACTTTGCCAAGCAGTTCCTGTTGGCAGCGGAGGCCATTGATGACATACCCTTTGGGATCACGTCCAATAGTGACGTGTTCTCCAACTATCAGCTGGACAAGGACGGGGTTGTCCTCTTCAAGAAGTTTGACGAAGGCCGGAACGACTTTGAGGGGGAGGTCACCAAAGAGAAGCTGCTGGCCTTCATCAAGCACAACCAGCTGCCGCTGGTCATCGAGTTCACCGAGCAGACGGCCCCGAAGATTTTTGGAGGGGACATCAAGACTCACATTCTGCTGTTCCTGCCCGAGAGTGCGCCTGACCGCGACGGCAAGCTGAGTGGCTTCAAGAAGGCTGCCGAGCGCTTCAAGGGCAAGATCCTGTTCATCTTCATCGACAGCGACCACGCCGACAACCAGCGCGTGCTCGAGTTCTTCGGCCTGAAGAAGGAGGAGTGTCCGGCCGTGCGCCTGATCACCCTGGAGGAGGAGATGACCAAGTATAAGCCAGAGTCAGCCGGGCTGACGGCAGACGAGATCACGGACTTCTGCCAGCGCTTCCTGGATGGCAAGGTCAAGCCACACCTGATGAGCCAGGAGCTGCCTGAGGACTGGGACAAGCAGCCTGTCAAAGTGCTGGTTGGGACCAACTTTGAAGAGGTGGCTTTCGATGAGAAGAAGAACGTCTTCGTGGAATTCTACGCCCCCTGGTGCGGCCACTGCAAACAGCTGGCTCCCATTTGGGATAAGCTGGGAGAGACGTACAGGAACCACGACAACATTGTCATCGCCAAGATGGACGCGACGGCCAACGAGGTGGAGGCCGTTAAAGTTCACAGCTTCCCCACGCTCAAGTTCTTCCCTGCCAGCGCAGACAAGACGGTCATCGACTACAACGGGGAGCGCACCCTGGAAGGCTTTCGCAAGTTCTTGGAGAGTGGCGGCCAGGACGGGGCAGGGGATGACGATGATCTCGAAGACCTAGAGGAGGCAGAAGAGCCCGACCTGGAGGAAGACGACGATCAGAAAGCTGTGAAGGACGAACTGTGATGTCACAACCAGCCCAGCACCCTGACGCGCCCTCGGAGCTGCAGCCCCTCAGCGAGGCTTGGGAGCCCGGGAGCCCGGGCCCCCGGGGAGGAGGCGCACCAGCCAGAAGTGCGGGGGACTTCCTGAGGCGACACCTCACTGACACGCGTAGGCTTAGACCCGCCTCTCCTTCCGCCTTTCCGTTCCTGGAAAGGACCCTCCCCAGGCCAACGTCGGGGCCCATTTTTTTAATTGATGTACTTTTTCGTACACGGTTTCTTCCAGAACGCGCCCAAAAATGTTTGCGAATCTCACGTGGCAGTGTCTCCTTCCCGTTAGGTTTATACTATCACTTTTAAAAATTTCCATCTGTGGGATTCTTGGACATTTTTGGACATCGGGGTCTCTGCTCACCTTGGTCGGGTCACCCTGGAGACCGATGTGCCCTGTGTGGAAAGGGCCCAAGCCATGCTGGACGGGTCACCCCCCTCACACCCATGTTGCTGTGACCGAGTGTGGCTCCCGCAGCGTGTGGTTAAATGGAGACTTCCGGTCTCTGTCGCAGAGGCCGCCATGACTGGGGGGTGCCGGTGGGGCCAAGACAGGGCCTTCTCCCCGAGCCAGGCTCCTCACCGCGGAGGCCTGAGCCGGCCTGAACCAGGACCCTCCACTTCCAGGCTGGGACACAGCCGCGGGAGCTCGAGCCCGGCCAGCCGTTAGCGGTCCTCAGGTCCCTCCACCACAGCGTGGGGACAACTCATTGGCCAAATAAACTTCCAATTTC