Transcript asmbl_28726

Sequence
Transcript Sequence for observation asmbl_28726 of TGE0004664:
GGCTGGGGCAGGCCTCCTTTGTGGCCGCGCCAGTGGCCCTCGGGCCCACCTTCCCAGCCGGTGCGCGCGGGAAGGGACCAGGCCTGACGCCCTTACCCCGAAGAAGGCGCGCCCGTCTTCTGGACATCCCCGAGCTCCCCACCCCACTTAACCCCACCCCGCGCCTGGCCCAGATTGCGGGGCCCAGCGAAAGTACGGGCGGCGGCATCGCTCTCGGAGGATCCTGTCGCCTGCGGCCGCACTGGGTGGCGTTAGGGCGTGAGCCTTCTACAGGAATTCCAGAGGAAGCGGCTGGGAGGCCTGGAAGAGCCGGCGGCCCCACCCTGCCTGCGGCGGCCGGCCCGCTCTAGGTGTGGCAGATCCAGCTAGAGGCAGCATGGCCGAGCAGGAGCCCACCGCCGAGCAGTTGGCGCAGATTGCGGCGGACAACGAGGAGGACGAGCACTCGGTGGGCTACCGGCCCCCGGCCCAGAAGAGCATCCAGGAGATCCAGGAGCTGGACAAGGACGACGAGAGTCTGCGCAAGTACAAAGAGGCCCTGCTGGGCCGTGTGGCTGTGGCCGCTGACCCCAATGTCCCCAACGTTGTTGTGACCCGCCTGACCCTGGTGTGCAGCACAGCCCCGGGCCCCCTGGAGCTGGACCTGTCTGGGGACCTGGAGAGCTTCAAGAAGCAGTCGTTTGTGCTGAAAGAGGGTGTGGAGTATCGGATAAAGATCTCTTTCCGGGTGAACCGAGAGATCGTGTCCGGCATGAAGTACATCCAGCACACGTTCCGGAAAGGCGTCAGGATCGACAAGACCGACTACATGGTGGGGAGCTACGGGCCGCGCGCCGAGGAGTACGAGTTCCTGACGCCCGTGGAGGAGGCGCCGAAGGGCATGCTGGCCCGCGGGAGCTACAACATCAAGTCCCGCTTCACAGACGACGACAAGACTGATCACCTGTCCTGGGAGTGGAATCTCACCATCAAGAAGGAGTGGAAGGACTGAGCGTAGGCCTGGAGGCAGGCAGGGTGATGGCGGGGCGCACCCCCCACCCCTCCCCCACCCCCATACCAAAGTGCTGACAGGGCGCCTGCCCACGCTGCGGTCTTTCCCCCTGGTCCGCCTCCCGGCCAGCCCGGCCCCCCTCGACCCTCCCCAGCCTGCAGCCCCCAGCCTCCTGGGTGGTCTCGTGTCACTGCTGCTTCATTCTGTGCTGTGAGGGGAGGACGGCCGTAGCCCAGGCCTCCCCCTCCCCCTCTGTGTCCCTCCACGTTCCCCCACCTGTCCTGACCCCGCCTGAGGCCCTGGCTTTTCCGAGGCAGTGGGGCATTGGATGGGGTCTCGTGGTTTCAGTTGCCCCAACTCCCATCGTCTCCCCCTGCGGGGTGGGGGTGGGGTGCATGATGCAGGGCCTTGTGGGGACCAGCCGTCCCCCAGCTGTCACTCTTCCCTGGTCAGCTTGCCCACCGTTGTCAGTAACCATCTAACCATGATGCCTTAACATGCAGAACGTGTGCGTGGGGCCGTCACTAATCTCTGACCCCTGTGTCTGCATGAGCATGTGGTCTCCCCCAGTCCCTTTCCCAGCTGCAGTCCCGGTCGCCCAGGGAGGTGTAGGATGTGCTGCTGCTGTTCCCCGGCCTGCCAGGGCCTGGCCAGCCCCCTCCCCGTGGCCCTCCCCTAGCCCGGGCTGTGGGGACAGTCCCAGGCGCTTAGGGAAAGCCAAATTGCCAAAACTCAAGTCGCCTCCAGTCTCATCGGGGAGGCTGGGTGTCCTCATGCCTCTGCCTTCTTTGTCCCAGTGGGCAGCACCCAGACCCAGACCCCACAGCCCCGACAGACAGCCCTCGGTGGACAAAGCCAGCAGCCGAGCCTTACTTGTCCCACCTGGGCCCACCGGCCTGGAGTGGCATGCCTGGCCTGTCAGTATTTATTGCCTCCATATGTGCCGTCCTCTGGGCCCGCTGGCCTGCCACCTCTGCCCCCAGGCTCGGTGCCACCATCCCTGGCAGGCCCTCCCCGGACCCAGCCAGGACACCCGTGGGACCAAGCATGCACAGTCGGAGCTGTCCCCTGTGCCACCCCTCCCCTCGCTGGTCAGGCCCGGGCTGGAACACAGGAACCCGTCCCTGCTTCTCCTTTTCAGACCAGGAAATAAACTCCCCCCCAGAGGA