Transcript asmbl_17925

Sequence
Transcript Sequence for observation asmbl_17925 of TGE0000474:
GATTGGGAAGTTCAGCCATGAATATACAAATGCTTTTGGAAAAACTCAAAGGAATTCCCCAGTTAGAAGGCCAGAAGGACATGATAACGTGGATACTTCAGATGTTTGACACAGTGAAGCGATTAAGAGAAAAATCTTGTTTAATTGTAGCAACCACATCAGGATCGGAATCTATTAAGAATGATGAGATTACTCATGATAAAGAAAAAGCAGAACGAAAAAGAAAAGCTGAAGCTGCTAGGCTACATCGCCAGAAGATCATGGCTCAGATGTCTGCCTTACAGAAAAACTTCATTGAAACTCATAAACTCATGTATGACAATACATCAGAAATGCCTGGGAAAGAAGATTCCATTATGGAGGAAGAGAGCACCCCAGCAGTCAGTGACTACTCTAGAATTGCTTTGGGTCCTAAACGGGGTCCATCTGTTACTGAAAAGGAGGTGCTGACGTGCATCCTTTGCCAAGAAGAACAGGAGGTGAAAATAGAAAATAATGCCATGGTATTATCGGCCTGTGTCCAGAAATCTACTGCCTTAACCCAGCACAGGGGAAAACCCATAGAACTCTCAGGAGAAGCCCTAGACCCACTTTTCATGGATCCAGACTTGGCATATGGAACTTATACAGGAAGCTGTGGTCATGTAATGCACGCAGTGTGCTGGCAGAAGTATTTTGAAGCTGTACAGCTGAGCTCTCAGCAGCGCATTCATGTTGACCTTTTTGACTTGGAAAGTGGAGAATATCTTTGCCCTCTTTGCAAATCTCTGTGCAATACTGTGATCCCCATTATTCCTTTGCAACCTCAAAAGATAAACAGTGAGAATGCAGATGCTCTTGCTCAACTTTTGACCCTGGCACGGTGGATACAGACTGTTCTGGCCAGAATATCAGGTTATAATATAAGACATGCTAAAGG