Transcript asmbl_28698

Sequence
Transcript Sequence for observation asmbl_28698 of TGE0004660:
TCCGCACAGGTCAGTGGGCGTGAGGGCCCAGGGGGCAGCAGGAGGGACGCCTGGCAGGCCCCAGCCCAGCGAGCCCCAAGGGCACCCCAGCCGAGCGTCCAGAACCCCAGTCTGCCCGACCCCACCACCCCGTGTCCTGCAGGCTACCAGGCCAAGCAGGTCCGCGAGTGGAAGCGCCAGGGCGTGCACGTGCTCTTGTCCACCAGCAACGCTATCTCTCTGGAGGGGGCCCGGAGCCTCATTGCTGAGGCCACGCAGCTTGGGCCTGTTGGCGGTGTCTTCAACCTGGCCGTGGTCCTGAGAGACGCCATGCTGGAAAACCAGACCCCCGAGCTATTCCAGGACGTCAGCAAGCCCAAGTACAGTGGCACGCTGAACTTGGACAGGGTGACCCGGGAGGCGTGCCCTGAGCTGGACTACTTCGTGGCCTTCTCCTCCGTGAGCTGCGGGCGCGGCAACGCGGGCCAGACCAACTACGGCTTTGCCAACTCCACCATGGAGCGCATATGCGAGCAGCGCCGGCACGATGGCCTCCCAGGCCTCAGTGTGCAGTGGGGCGCCATCGGCGACGTGGGCATCGTGCTGGAGACCATGGGCGGCAACGACACGGTCGTGGGCGGCACGCTGCCCCAGCGCATCGCATCCTGCCTGAACGTGCTGGATCTCTTCCTGAGCCTGCCCTACCCTGTCCTGAGCAGCTTCGTGCTGGCCGAGCAGACGGCCACAGGCCACAGAGACGGCGATGGCCAGCAAGACCTGGTGAAGGCCGTGGCGCACGTCCTGGGCATCCGGGACCTGGCCACGGTCAACATGGACAGCTCACTGGTGGACCTGGGTCTGGACTCGCTCATGGGCGTGGAAGTGCGGCAGATCTTGGAGCGGGAGCACGACCTGGTCATGTCCCTGCGCGACATCCAGCAGCTCACGCTGCGGAAGCTGCAGGAGCTGTCGTCGCAGGACAGCA