Transcript asmbl_70807

Sequence
Transcript Sequence for observation asmbl_70807 of TGE0002382:
CTAGTCCGCAGTCCTGTCCGCGGCCTCATCTGGGCTTCTCTGGCCCGGGGCACGCTGGTCCGGCGAGTCAGCGGTCTCTTTCCTGGGTACCAGAGACGGAAGCCGGAGGGGCACGGGGAGGAGCTTTGCGCGCGGGGTGAACGCTCGCCTTACGTGCTCGTTCGCCTCGCGACCGCTGCGCGCGAACCCGGTGTCCCCGCGGCGGCGTCGGTGGAACGCGGAGGGGGCGGAGGGAGCCCGCGGCGGCGGCAACAGCGAAATGGCGGAGACGGTGGCGGACACCCGGCGGCTGATCACCAAGCCGCAGAATCTGAATGACGCCTACGGGCCGCCCAGCAACTTCCTCGAGATTGATGTGAGCAACCCGCAGACGGTGGGGGTCGGCAGGGGCCGCTTCACCACCTATGAGATCAGGGTCAAGACAAATCTGCCTATTTTCAAGCTGAAGGAATCTACTGTTAGAAGAAGATACAGTGACTTTGAATGGCTACGAAGTGAATTAGAAAGAGAGAGCAAGGTTGTGGTTCCCCCGCTCCCTGGGAAAGCATTTTTGCGTCAACTCCCTTTTAGAGGAGATGATGGAATATTTGATGACAATTTTATTGAAGAAAGGAAGCAAGGGCTGGAGCAGTTTATAAACAAGGTCGCTGGTCATCCTTTGGCACAGAATGAACGTTGTCTTCACATGTTTTTACAGGATGAAATAATAGATAAAAGCTATACTCCATCTAAAATAAGGCATGCTTGAAATTTGGCAAGAAGAGGCAAAAAAAACTTTCCGTGACTATTATTGATTCATATGCACCAGTGAAGAAGTTCTAACTAACTTTTAGCATGCTGCACAGAAACTGGTATAACATGCCTTCCATATACTAACACTCATATGCTCTGTTTTGTTTTGGCAGTTGACAAGAATTTAATTTGCTTTAGTGAAAATCCCTCATTCTAGCCTTTCTATATAATAGCTCTTCCTTGCTCTTTTAAGGTGGTATACACGATAGCTTCACAAACCTGTTACCAGTATAATCTGCAGTGTCCTAACTAAAGCTACTGACTTGGTCTTATCTGCACAGTTTTTGTGTCATGTTTGCTTCTTGAATCTGATAAACTAGAATATTTCTCTTATCCCCTTTTTAATATACGATGTCACTTGACCTAATTTATGTGTAGGAGCACTACACCATCCGTTTCCAGCACCCTACATGTAAGATACACACTTGTGTGCAGAAAGTATATCCCTTCAGGCTTGTAATACCCTTCACATGGAAGATCAGTGAGGGAAATCTTTATATTCTGTATAAAAACAAAATCAAATTTATATACTAAAATCATTTGTCTAAAAAATTTAAGTTGTTTTCAAATAAAAATAAAAATGCATTTCTG