Transcript asmbl_70668

Sequence
Transcript Sequence for observation asmbl_70668 of TGE0007600:
GGGCGCTGAGTGGTTTTTCGGAACATGTCTGGTGGCTCCGCGGATTATAACAGAGAACATGGCGGCCCAGAGGGAATGGACCCCGATGGTGTCATCGAGAGCAACTGGAATGAAATTGTTGATAACTTTGACGATATGAACTTAAAGGAGTCTCTACTACGGGGCATCTATGCTTATGGTTTTGAGAAGCCTTCAGCTATTCAGCAGAGAGCTATTATTCCTTGTATTAAAGGGTATGATGTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTCCATCCTGCAACAGTTGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCACCAGAGAACTGGCTCAACAGATCCAAAAGGTAATTCTGGCACTTGGAGACTACATGGGAGCAACTTGTCATGCCTGCATTGGTGGAACCAATGTTCGAAATGAAATGCAAAAACTGCAGGCTGAAGCACCACATATTGTTGTTGGTACACCAGGGAGAGTGTTTGATATGTTAAACAGAAGATATCTTTCTCCAAAATGGATCAAAATGTTTGTTTTGGATGAAGCAGATGAAATGTTGAGCCGAGGATTTAAGGATCAAATCTACGAGATTTTCCAAAAATTAAATACAAGTATTCAGGTGAGCTTTTATTTTTCTTCTGTAGCTGGAGATTAGGTTTATGCAGGTACTGTTAGAATACAACTGAAGTGTTCTATTGTCGTTTCCTCTGTTTAAAGTAATTGATGCATAACTGCCTGTCTACTGCAATTCCTTAGCAAGACAGAGACTCTTGGTCTCAAACACGTAGAGTATTGTGATGGTTGTGCTAATTAACTGCTTGTGTGACATCATCATCATTGTCCTTTTAAGGTTGTGTTGCTTTCTGCCACTATGCCAACTGATGTGTTGGAAGTGACCAAAAAATTCATGAGAGATCCAATTCGAATTCTGGTGAAGAAGGAAGAATTGACCCTTGAAGGAATCAAACAGTTTTATATTAATGTTGAAAGAGAGGAATGGAAATTGGATACGCTTTGTGACTTGTATGAGACCCTCACCATTACACAGGCTGTTATTTTTCTCAATACAAGGCGCAAGGTGGACTGGCTCACTGAGAAAATGCATGCCAGAGACTTCACAGTTTCCGCTTTGCATGGTGATATGGACCAGAAGGAAAGAGATGTTATCATGAGGGAATTCCGATCAGGGTCAAGCCGTGTTCTGATCACTACTGACTTGTTGGCTCGTGGGATTGATGTGCAACAAGTGTCATTGGTTATAAACTATGATCTACCTACCAATCGTGAAAACTATATTCACAGGAGTCGATAGCAGCAGTTGATGGCGAGATGGCACTCAGAAACGGCGTTGACGTAATTTAGGACGTGGAATCATAAGCGAAACAGCACACTGTTTGAATAAAGAGCGAGTCGGTATTTATATTTGTTTTTCTTTTGTCATGATTATTTGATATTTTAAGTTGTTCCAGCCAAGGCATTTTTGTATAATAATAGTCTCTTAGGTGGTTTGTATTGTCTGGTTTCTATCAGGGAGGTAGAAAAGTTTGTTTCGGAGGTAAACACGTTTGAGTAATTTGAGTTATAACGTGTGAAACTGAGCAAAAAAGCAGTGATGAGTTTGGGTTACCATACCAAATACTTGTTTTCCCACTGGAAAAAGTTGTTTTAGACAGTAGTTAACCTTGCTTGCAGCATTTGTGTTTACAGTTTACAGTTCCAGAAGTGCGTCGAAATGGATTACATAACTGTTCTTTTTGTTTTATTCCTGGTGTTTACATCTGTCCCAGGCTGACATCTGCTCTTGGCTGGCCCACTTTGGTATGGGCTTTTTAATTTCACTACCCCAAACACAATACTGTCATCTGCTTTAAAAATAATGCTCAAGACACCTGATAAAATCTCATTTTGCAGCCAGACAAGCCTTGAATCCTTTTGCCACTAACTGCAAAGGAAGACTTCTTTCTCTAGATATTGATTAGCAGATAGTGCTCCAGTTAGAAGCACGAACTATAACCTTGATAAGTAAACAGCAGCTGATGGTTAACAAGTGGATCATCATGTTCAGTAGTTCACACAGTATGTGGGAAGTAACATTCTAATTGTTGATTTCTTTTCTTACACAGAATTGGCAGAGGGGGTCGATTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTACTGAAGAAGACAAGAGGATTCTTCGTGACATTGAGACTTTCTACAACACTACAGTGGAGGAAATGCCTATGAATGTGGCTGACCTTATTTAATTCCTGGGATGAGATAGTTTTGAATGCAGTGCCCGCTGTTGCTGAATAGGCGATCACAACGTGCATTGTGCTTCTTTCTTTGGGAATTTTGAATCTTGTCTCAATGCTCATAACGGATCAGAAATACAGATTTCGTGAGCTCTTGTGAGGAAAGTCATTGGCTTTATCCTCTTTAGAGTTAGACTGTTGGGGTTGGGTATAAAAGATGGGGTCTGTAAAATCTTTTTTTCTTAGAAATTTATTTCCTAGTTATGTAGAAATGGTTGTATTAGATGTTCTCTATCATTTAATAATATACTTGTGGACTAAAAGATATAAGTGCTGTATAAAATCAGCCAATTATGTTAAACTAGCTTACCTGCCTTTATTGTGTTTGTCATTAGCCTGGAATAGAAAGGCCTTTAAAACTGATTTTTTTTAGAGAGCATTTGAATGCATTTTGTTTGGTATTGTATTTATTCAATAAAGTATTTAATTAGTGCTAAGTGTGAACTGGACCCTGTTGCTAAGCCCCAGCAAGCAATCATCCTAGGTAGGGTTAAAACCCCAGTAAAATTGCCATATTGCACATGTCTTAATGAAGTTTGAATGTTAAATAAATTGTATATTCACTTTAAA