Transcript asmbl_70666

Sequence
Transcript Sequence for observation asmbl_70666 of TGE0031446:
GGGCGCTGAGTGGTTTTTCGGAACATGTCTGGTGGCTCCGCGGATTATAACAGAGAACATGGCGGCCCAGAGGGAATGGACCCCGATGGTGTCATCGAGAGCAACTGGAATGAAATTGTTGATAACTTTGACGATATGAACTTAAAGGAGTCTCTACTACGGGGCATCTATGCTTATGGTTTTGAGAAGCCTTCAGCTATTCAGCAGAGAGCTATTATTCCTTGTATTAAAGGTAAAAGAACTCAGCACTTTTTAAAAACGATTCAGTTTTACATAGACCTGGACCATTAAAAGGGAAAATAACTTCTGGGGGACTAGCACCTATTTGTATTCCTTAAAGTGAAATGATGGCAATCATCTTTCGGGACTGACCTGAAATGAAGAGAATACTCATTGCTGATCACTTAATTATTTGGGCATAATTCATGTTCCAAATGGAATACATAGTGTGAACTAGAAGTGACGGTTTGGTGTGGGATCGGTAAATATGTATCCTACTTTTTTTAGGGTATGATGTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTCCATCCTGCAACAGTTGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCACCAGAGAACTGGCTCAACAGATCCAAAAGGTAATTCTGGCACTTGGAGACTACATGGGAGCAACTTGTCATGCCTGCATTGGTGGAACCAATGTTCGAAATGAAATGCAAAAACTGCAGGCTGAAGCACCACATATTGTTGTTGGTACACCAGGGAGAGTGTTTGATATGTTAAACAGAAGATATCTTTCTCCAAAATGGATCAAAATGTTTGTTTTGGATGAAGCAGATGAAATGTTGAGCCGAGGATTTAAGGATCAAATCTACGAGATTTTCCAAAAATTAAATACAAGTATTCAGGTTGTGTTGCTTTCTGCCACTATGCCAACTGATGTGTTGGAAGTGACCAAAAAATTCATGAGAGATCCAATTCGAATTCTGGTGAAGAAGGAAGAATTGACCCTTGAAGGAATCAAACAGTTTTATATTAATGTTGAAAGAGAGGAATGGAAATTGGATACGCTTTGTGACTTGTATGAGACCCTCACCATTACACAGGCTGTTATTTTTCTCAATACAAGGCGCAAGGTGGACTGGCTCACTGAGAAAATGCATGCCAGAGACTTCACAGTTTCCGCTTTGCATGGTGATATGGACCAGAAGGAAAGAGATGTTATCATGAGGGAATTCCGATCAGGGTCAAGCCGTGTTCTGATCACTACTGACTTGTTGGCTCGTGGGATTGATGTGCAACAAGTGTCATTGGTTATAAACTATGATCTACCTACCAATCGTGAAAACTATATTCACAGGAGTCGATAGCAGCAGTTGATGGCGAGATGGCACTCAGAAACGGCGTTGACGTAATTTAGGACGTGGAATCATAAGCGAAACAGCACACTGTTTGAATAAAGAGCGAGTCGGTATTTATATTTGTTTTTCTTTTGTCATGATTATTTGATATTTTAAGTTGTTCCAGCCAAGGCATTTTTGTATAATAATAGTCTCTTAGGTGGTTTGTATTGTCTGGTTTCTATCAGGGAGGTAGAAAAGTTTGTTTCGGAGGTAAACACGTTTGAGTAATTTGAGTTATAACGTGTGAAACTGAGCAAAAAAGCAGTGATGAGTTTGGGTTACCATACCAAATACTTGTTTTCCCACTGGAAAAAGTTGTTTTAGACAGTAGTTAACCTTGCTTGCAGCATTTGTGTTTACAGTTTACAGTTCCAGAAGTGCGTCGAAATGGATTACATAACTGTTCTTTTTGTTTTATTCCTGGTGTTTACATCTGTCCCAGGCTGACATCTGCTCTTGGCTGGCCCACTTTGGTATGGGCTTTTTAATTTCACTACCCCAAACACAATACTGTCATCTGCTTTAAAAATAATGCTCAAGACACCTGATAAAATCTCATTTTGCAGCCAGACAAGCCTTGAATCCTTTTGCCACTAACTGCAAAGGAAGACTTCTTTCTCTAGATATTGATTAGCAGATAGTGCTCCAGTTAGAAGCACGAACTATAACCTTGATAAGTAAACAGCAGCTGATGGTTAACAAGTGGATCATCATGTTCAGTAGTTCACACAGTATGTGGGAAGTAACATTCTAATTGTTGATTTCTTTTCTTACACAGAATTGGCAGAGGGGGTCGATTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTACTGAAGAAGACAAGAGGATTCTTCGTGACATTGAGACTTTCTACAACACTACAGTGGAGGAAATGCCTATGAATGTGGCTGACCTTATTTAATTCCTGGGATGAGATAGTTTTGAATGCAGTGCCCGCTGTTGCTGAATAGGCGATCACAACGTGCATTGTGCTTCTTTCTTTGGGAATTTTGAATCTTGTCTCAATGCTCATAACGGATCAGAAATACAGATTTCGTGAGCTCTTGTGAGGAAAGTCATTGGCTTTATCCTCTTTAGAGTTAGACTGTTGGGGTTGGGTATAAAAGATGGGGTCTGTAAAATCTTTTTTTCTTAGAAATTTATTTCCTAGTTATGTAGAAATGGTTGTATTAGATGTTCTCTATCATTTAATAATATACTTGTGGACTAAAAGATATAAGTGCTGTATAAAATCAGCCAATTATGTTAAACTAGCTTACCTGCCTTTATTGTGTTTGTCATTAGCCTGGAATAGAAAGGCCTTTAAAACTGATTTTTTTTAGAGAGCATTTGAATGCATTTTGTTTGGTATTGTATTTATTCAATAAAGTATTTAATTAGTGCTAAGTGTGAACTGGACCCTGTTGCTAAGCCCCAGCAAGCAATCATCCTAGGTAGGGTTAAAACCCCAGTAAAATTGCCATATTGCACATGTCTTAATGAAGTTTGAATGTTAAATAAATTGTATATTCACTTTAAA