Transcript asmbl_70664

Sequence
Transcript Sequence for observation asmbl_70664 of TGE0007602:
GGGCGCTGAGTGGTTTTTCGGAACATGTCTGGTGGCTCCGCGGATTATAACAGAGAACATGGCGGCCCAGAGGGAATGGACCCCGATGGTGTCATCGAGAGCAACTGGAATGAAATTGTTGATAACTTTGACGATATGAACTTAAAGGAGTCTCTACTACGGGGCATCTATGCTTATGGTTTTGAGAAGCCTTCAGCTATTCAGCAGAGAGCTATTATTCCTTGTATTAAAGGGTATGATGTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTCCATCCTGCAACAGTTGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCACCAGAGAACTGGCTCAACAGATCCAAAAGGTAATTCTGGCACTTGGAGACTACATGGGAGCAACTTGTCATGCCTGCATTGGTGGAACCAATGTTCGAAATGAAATGCAAAAACTGCAGGCTGAAGCACCACATATTGTTGTTGGTACACCAGGGAGAGTGTTTGATATGTTAAACAGAAGATATCTTTCTCCAAAATGGATCAAAATGTTTGTTTTGGATGAAGCAGATGAAATGTTGAGCCGAGGATTTAAGGATCAAATCTACGAGATTTTCCAAAAATTAAATACAAGTATTCAGGTTGTGTTGCTTTCTGCCACTATGCCAACTGATGTGTTGGAAGTGACCAAAAAATTCATGAGAGATCCAATTCGAATTCTGGTGAAGAAGGAAGAATTGACCCTTGAAGGAATCAAACAGTTTTATATTAATGTTGAAAGAGAGGAATGGAAATTGGATACGCTTTGTGACTTGTATGAGACCCTCACCATTACACAGGCTGTTATTTTTCTCAATACAAGGCGCAAGGTGGACTGGCTCACTGAGAAAATGCATGCCAGAGACTTCACAGTTTCCGCTTTGCATGGTGATATGGACCAGAAGGAAAGAGATGTTATCATGAGGGAATTCCGATCAGGGTCAAGCCGTGTTCTGATCACTACTGACTTGTTGGCTCGTGGGATTGATGTGCAACAAGTGTCATTGGTTATAAACTATGATCTACCTACCAATCGTGAAAACTATATTCACAGAATTGGCAGAGGGGGTCGATTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTACTGAAGAAGACAAGAGGATTCTTCGTGACATTGAGACTTTCTACAACACTACAGTGGAGGAAATGCCTATGAATGTGGCTGACCTTATTTAATTCCTGGGATGAGATAGTTTTGAATGCAGTGCCCGCTGTTGCTGAATAGGCGATCACAACGTGCATTGTGCTTCTTTCTTTGGGAATTTTGAATCTTGTCTCAATGCTCATAACGGATCAGAAATACAGATTTCGTGAGCTCTTGTGAGGAAAGTCATTGGCTTTATCCTCTTTAGAGTTAGACTGTTGGGGTTGGGTATAAAAGATGGGGTCTGTAAAATCTTTTTTTCTTAGAAATTTATTTCCTAGTTATGTAGAAATGGTTGTATTAGATGTTCTCTATCATTTAATAATATACTTGTGGACTAAAAGATATAAGTGCTGTATAAAATCAGCCAATTATGTTAAACTAGCTTACCTGCCTTTATTGTGTTTGTCATTAGCCTGGAATAGAAAGGCCTTTAAAACTGATTTTTTTTAGAGAGCATTTGAATGCATTTTGTTTGGTATTGTATTTATTCAATAAAGTATTTAATTAGTGCTAAGTGTGAACTGGACCCTGTTGCTAAGCCCCAGCAAGCAATCATCCTAGGTAGGGTTAAAACCCCAGTAAAATTGCCATATTGCACATGTCTTAATGAAGTTTGAATGTTAAATAAATTGTATATTCACTTTAAA