Transcript asmbl_28596

Sequence
Transcript Sequence for observation asmbl_28596 of TGE0000808:
CTTGTCGCTTGCTGTGAGTGTCTCTGTGGCGGGATGCAGGGAATAGGGGGGTAATCCGAGGTACCGGCGCGCGCCCTCCGCCCTCATAGCCATGCCTCGCAAAATTGAGGAGATCAAGGACTTCCTGCTCACGGCCAGACGAAAAGATGCCAAATCTGTCAAGATCAAGAAAAATAAGGATAATGTGAAGTTTAAAGTTCGGTGCAGCAGATACCTTTACACCTTGGTCATCACAGACAAAGAGAAGGCCGAGAAACTGAAGCAGTCCCTGCCCCCCGGTTTGGCAGTGAAGGAGCTGAAATGAACCAGACATGCTGATCTGAACTGCATTAAAATTTTT