Transcript asmbl_28591

Sequence
Transcript Sequence for observation asmbl_28591 of TGE0004643:
GCGGCGCGGGGCGGGGATTGGCTTCTTCCTCGGCTCATAGCAGTTCGCGGCTGCAGTTCGTGGGACACCTGCTAGTTCCTCCGGCGCGGGGGCTTCTTGCCGCGCTCTCTCCAGCCTCCCGGTCCGCAGGGCTGGGTAAAGGGCTGGACCGTCCGGTCTCCGATCCCTTTACAGGACTCCGCGTCGCGCCGCTGAGCCGTCGCAGGGCGAGATGAGCGCGGACGCAGCGGCCGGGGCGCCCCTGCCCCGGCTCTGCTGCCTGGAGAAGGGTCCGAACGGCTATGGCTTCCACCTGCACGGGGAGAAGGGCAAGGTGGGCCAGTTCATCCGGCTGGTGGAACCCGGCTCGCCAGCCGAGAGGTCGGGGCTGCTGGCCGGAGACCGGCTCGTGGAGGTGAACGGCGAGAACGTAGAGAAGGAGACCCACCAGCAGGTGGTGAGCCGCATCCGCGCGGCGCTCAACGCCGTGCGTCTGCTGGTGGTCGACCCCGAGACGGACGAGCGGCTGCAGAAGCTGGGCGTCCAGGTCCGGGAGGAGCTGCTGCGCACCCAGGAAGGGCCCTCGCAGGCCGAGCCGCCGGCCGCCGCCGAGGCGCAGGGGGCTGGCGACGAAAATGAGCCACAGGCCGCCGCGCCGGAACCGGGGGAGGCGGAGAAGAGCCATCCGGAGCTGCGTGAGCTTCGGCCTCGGCTCTGCACCATGAAGAGGGGCGCCAACGGCTATGGCTTCAACCTGCACAGCGACAAGTCCAAGCCAGGCCAGTTCATCCGGTCAGTGGACGCAGACTCGCCCGCCGAAGCCTCAGGGCTCCAGGCCCAGGATCGCATCGTAGAGGTGAACGGGGTCTGCATGGAGGGCAAGCAGCACGGGGACGTGGTATCTGCCATCAAGGCTGGTGGGGACGAGACCAAGCTGCTGGTGGTGGACAGAGAGACCGATGAGTTCTTCAAGAAGTGCAAAGTGATCCCATCTCAGGAGCATCTGAATGGTCCCTTGCCTGAGCCCTTCACCAATGGGGAGATCCAGAAGGAGGCGGCCTCCGAGAACCCCAGACCGATGCTGGCAAGGTCCACCTCCAGTGACACCAGTGAAGAGCTGAATTCTCAAGACAGCCCCAAGGAACAGGACCCCACGGCACCCTCATCTACCTCTTCCTCCTCCGACCCCATCCCGGACTTCACCATCTCCCTGGCCGCGGCCAAAGAGAGGGCCCACCAGAAGCGCGGCAACAAGCGGGCCCCGCAGATGGACTGGAGCAAGAAAAACGAACTCTTCAGCAACCTCTGAGCGCGTCCCCCGGCCACCCGGGAAAGCTGGAGGGCTGGGCCCACACCCCAACTCAGCCCCCTTCCCCTCCCCGCCCCCCACTCACCCACGAATGACTTACAAATCAGCACCAGCATCTCCCCTCTTGGCCAATCTGATTTTTCTAGAGAACTACATGAATGTTTGCCTTTCCTACTCCAATCAAAGAGCAGACTGTCCCCCTCCTCGCAGAGGGCTTCAGCCCACCAGGTGTCTGCTCGCCACCCCTCCCGGGACATCACTGGGAGCTACACCATGCAAGGACCATGGGACTGGGAGAGGGGTCACGGCCTCAAGTGATGACTGGGCCCAGGGTTGGAGGACTTGGATTACAGCAGTAAGCACCTCATCCTGAGAGGGCTGGGTTGGGCATCTTATTTTCGTTCA