Transcript asmbl_66698

Sequence
Transcript Sequence for observation asmbl_66698 of TGE0007406:
CGCAAGGTGGGGAGGTGCGGAGCTGGGCTTTGGGAGGCGGGGCGCGCGCGGGGGGGTACCCCTCCCTTCGGTCCTCCTTGCGGTGGACGGGTCTGCCTGCCCAGATCCGCCGCCCAGCGAGGATCCAAGGCATCTGTGCGGCCCGGGGGGCTCGGCCGGGACAAGCTAGGGGCACGGTGCCCGGGGCGGGTGGGCGGTGACCCGACGCAGGGCAAGCGGAAGAATAGATTCGCGGACCTCCGAGGGGAACCTGAGAGTGCAGACCTTGAGCGGACGTGAAACCGGCGCGGTCCGGGGGCCGGGAACTGCTCAGCGCTGCAGGGCTCCACGGCGCTGCCCGCCCGCGCGTTTCCAGGGGCGCGGGGAGCAGGTGAACAGGTCCTCGCTCACAGCTCCACGCCCTCACGCGCTCTCGCCCCGGCCTCCGCTCCCGCTTGCAGCCATGGGCCCGGGTCTCCGCCTCGCCACCCGCGTCCCACGCCAGATGCTTTGCGCGCTGGCCTTGATGGTGGCCGCTGGCGGCCGCATTGCCTCTGCTTTCAACCTGGACACCCAATTCCTGGTGGTGAAGGAGGCCAGGAACCCGGGCAGCCTCTTCGGCTACTCGGTCGCCCTCCATCGGCAGACGGAGCGGCGGCGGCGCTACCTGCTCCTGGCTGGTGCCCCCCGGGATCTTGCTGTGCCTGATGGCTATACCAACCGGACTGGTGCTGTGTACCTGTGCCCACTCACTGCCAACAAGGACGACTGTGAGCGGATGGACATCGGAGAGAAAAGTGACCCTGACCATCACATAATTGAGGACATGTGGCTGGGGGTGACTGTGGCCAGCCAGGGCCCTGCAGGCAGAGTCCTGGTCTGTGCCCACCGCTACACCCAGGTGCTGTGGTCGGGGCTGGAGGACCAGCGGCGCATGGTGGGCAAGTGCTATGTGCGGGGCAATGACCTAGAGCTGGACCGCACTGATGACTGGCAGACCTACCACAACGAGATGTGCAACAGCAACACTGACTACCTGGAGACGGGCATGTGTCAGCTGGGCACCAGTGGCGGCTTTACCAAGAACACTGTGTACTTCGGTGCTCCCGGTGCCTACAATTGGAAAGGAAACAGTTACATGATTCAGCGGAAGGACTGGGATTTATCTGAATACAGTTACAAGGGCCCAGAGGACCAAGGAAACCTCTATATTGGGTACACAGTGCAGGTGGGCAGTGCCATCCTGCACCCCACGGATATCACCATTGTGACAGGTGCCCCACGGCACCAACATATGGGCGCTGTCTTCTTGCTGAGCCAGGAGGTAGGCGGAGACCTGCGGAGGAGGCAGGTGCTGGAGGGCACACAGGTGGGCGCCTATTTTGGCGGTGCCATTGCCCTGGCAGACCTGAACAATGATGGGTGGCAGGATCTCCTGGTGGGTGCCCCCTACTACTTTGAGCGGAAAAAGGAGGTAGGGGGTGCCATCTATGTCTTCATGAACCAGGCAGGCACCTCCTTCCCTGCCCACCCCTCCCTCCTTCTTCACGGTCCTAGTCACTCTGCCTTTGGCTTCTCCGTGGCCAGCATTGGTGACATCAACCAGGATGGATTCCAGGACATTGCTGTGGGAGCTCCATTTGAAGGCTTGGGAACAGTGTACATCTATCACAGCAGCTCCAGGGGGCTTCTCCAACAGCCCCAACAGATAATCCACGGAGAGAAGTTGAGACTACCTGGCTTGGCCACCTTTGGCTACTCCCTGAGTGGGCGGATGGATGTGGATGAGAACTCCTACCCGGACCTGCTAGTGGGGAGCCTTTCAGACCGCATCGTGCTCCTGAGGGCGCGGCCTGTCATCAACATCCTCTATAAGACCTTGGTGGCCAGGCCTTCGGTGCTGGACCCCACACTCTGCACAGACACCTCTTGTGTGCAGGTGGAGCTGTGCTTTGCTTATAACCAGAGTGCTGGGAACCCCAACTACAGGCAAAATATCACCCTGGCCTATACACTGGAGGCTGACCGGGACCGCCGCCCACCCCGACTTCGCTTTGCACAGAGCCAGTCAGCTGTCTTTCATGGCTTCTTCTCCATGCCCGAGATGCGCTGCCAGACGTTGGAGCTGCTCCTGATGGACAACGTCCGTGACAAACTCCGTCCCATCGTCATCTCCATGAACTACTCTTTATCTTTGCGTATGCCGGAGCGCCCCAGGCTGGCGCTGCAGTCCCTGGACGCCTACCCGGTCCTCAACCAGGCGCAGGCTCTGGAAAACCACACTGAGGTCCAGTTCCAGAAGGAGTGTGGGCCGGACAACAAGTGCGACAGCAACTTGGAGATGCAGGCAGCCTTCGTGTCCGAGCAGGGGCAGCCGATGAGCAGGCTCCAGTACAGCAGAGACTTTGGGAAACTGCTCTTGAGCATCAATGTGACTAATATCCGGAGCAGGCAGCGGGCTGGAGAAGATGCCCACGAGGCGCAGCTCACCCTGGCGGTACCTCCCGCCCTGCTACCGTCCTCAGTGCGCCCTTTTGGGGCCTGCCAGGGCAACGAGACTATCCTTTGCCACCTGGGGAACCCCTTCAAACGGAACCAGCGGATGGAGCTACTCATCGTCTTTGAGGTCATCGGGGTGACCCTGCACACAAGGGAGCTCCAGGTGCAGCTGCAGCTGTCCACGTCAAGTCACCAGGACAATCTGCAGCCCATGACCCTGACTCTACTGGTGGATTACATGCTCCAGGCCTCACTCAGCATGGTGAGTCACCGGCTACAAAGCTACTTTGGGGGAACAGTGATGGGTGAGTCTGGCATGAAAACTGTGGAGGATGTGGGGAGCCCTCTCAAGTATGAGTTCCAGGTGAGCCCAATGGGGGAAGGGCTGGCAGCCCTGGGCACCCTGGTCCTAGGACTGGAGTGGCCCTACGAAGTCATCAATGGCAAGTGGCTGCTGTACCCTACAGAGATCACCATCCGCGGCAATGGGTCCTGGCCCTGCCAGCCACCCGGAGACCTTGTCAACCCTCTCAACCTCACTCTCTCTGTCCCTGGGGATAGGCTGCCAACTTCACAGCGTAGGCGAAGACAGCTTGACCCAGGGGGAGGCCAGGGCCCCCCACCTGCTACTCTGGCTGCTGCCAAAAAAGCCAAGTCTGAGACCCTGCTGAGCTGTGGCAGTGACCACACCCGCTGCGTGTGGCTGGAGTGCCCTATTCCTGATGCCCCTGTCATCACCAATGTGACTGTGCAGGCTCGAGTGTGGAACAGCACCTTTATTGAGGATTACAGGGACTTTGACCGAGTCAGGGTAACCAGCTGGGCTACCCTGTTCCTCCGAACCAGCATCCCCACCATTAACATGGAGAACAAGACCGTGCCGTTCTCTGTGGACATTGACTCTGAGCTGGTGGAGGAGCTTCCAGCTGAGATCGAGCTGTGGTTGGTGCTCGTGGCTGTAGGTGCCGGGCTGCTGCTGCTGGGGCTCATCATCCTCCTGCTATGGAAGTGCGGCTTCTTCAAGCGAGCCCGCACTCGCGCCCTGTATGAAGCCAAGAGACAGAAGGCGGAGATGAAGAGCCAGCCGTCAGAAACAGAGAGGCTGACCGAAGACTACTGAAGGGGGCGGCCCCTGCCCCCAACCCACCCGGTGTGACTTCTTTAAACGGACCCACTATTACCAGATCATGCCTAAGTACCACGCGGTGCGGATCCGGGAGGAGGAGCGCTACCCACCTCCAGGGGAGACCCTGCCCACGAAGAAGCACTGGGTGACCAGCTGGCACACTCGGGACCGATACTACTGACATCCTCCCTGATCCCACCCCCGTGCCCCCAGTGTCCCCTTCTATTTATCATAAGTTATGCCCTGACAGTCCACAGGGGCCACTGCCTTTGGCTGGCGCCAGCAGGCTCAGGCACACACACCTCTTCGAGCGCATACATGTGTCGTCTGGCCACAGACTTCTCCGCGCAGGAGTGCTGGGACCGTGGACCTTGCTCTGCCAAGCACACCACAGACCTGTGCCCTGGACACATGTGGATACATGTGGGTCCCACTGTGCTTGTGCACCACAGATGGTTTATGGACATGTGTGTCCCAGCCTCTGCTAGAGCCAGGAGGAAAAGGCTCCCAATGTGGTGACACCTTTCTTGTTCACACTGGACCCATCTTGAGCCATAGTCACTGGATGGACTCTGCTCTCAAGATTAAAACTACTGACAGGGAACAGCCCACCAGGCTGTACCTCAAGCTGTAGTTCCTGGCACCCATGCCAGAGAGCGTGAGGTCTGCCTGAGGTTGTCTAAGGGGGTGTTTGTAGGACCCAGCATGCTCAGACACAGAGCAGAATGAACTAAAATGAGGGTCCCCAGGATGACTTTCTTTCATGGATCTCTGTGAAGCCTCTCTCCTCAGCCACAGCATGTCCTAGCAGGGAATGCGGCCTAAAGGAACAAAGATAGACATCCTGGCATGCTGTGCGGGGACTGCCCTGGGAGCACAGTGGAATCCTCAACAGAGGAGGGGACCGGCCCTGGGCCAAGGAGATGTTGGAAGGATACATAAGAAATACCACTTCTCACCCATCACTACCATCCCGGCCTCTGAAGGGCCTGGAGAATTCCCACAAGATCACAGAGGGAGCGACACTTGAATGTAGGACAGGGAGGAAGCCCTGTCCCTGTCCCATTGGCCAGACCCCACTCTGCCCCCACTGACCAAGGGTTAGGGGCCAAGAAGTGGAGTTCTTGGCTGTCCTTGGCTTTCATCACCTATCGGCTCTGCCTTCTCCCCCATGGGCTGAGTCCTGAGGCCCATTCTAGAAGTCGAAGCTGGTTCCAAAAACCCTCTCCTGCCCCCTGCCTGTTGGCAGCTCCCCTTACCCCCTTCCACGGTACTGTAGTAGGGGAGCTCCCTCTCCCTCCTTGTGCCTTCTTTGTATATAGGCTTCTCACATCAACTAATAAACAGCTCCCTGTTTGTACACTC