Transcript asmbl_28500

Sequence
Transcript Sequence for observation asmbl_28500 of TGE0004630:
AGGTCACCATGGCTGCTGTTGGCTCCTTTGCTGTCCCCAGCTGTCCCCCAGGTCACCTCCCCTCCTTGCTGCCTGTGTCCAGAGAGCGTGCACAGGTTCCAGTGGATCAGAAACCTGGTTCCAGAGTTTGGAGTCTCCAGCTCTCACGTCAGGGTGCTGTCTTCTCCCGCAGAGTTTTTTGAGCTCATGAAGGGGCAGATAAAAGTAGCCAAGAGGCGGGTCGTGATGGCGTCCCTCTACCTGGGGACAGGTCCTTTGGAACAGGAGCTGGTGGATTGCCTGGAAAGCACTCTGGAAAAGTCACTCCAAGCGAAGTTCCCTTCAGACCTTAAGGTGTCCATTCTTTTGGACTTCACACGGGGATCACGAGGTCGGAAGAACTCTCGCACGATGCTGCTGCCACTCCTGCAGAGGTTCCCGGAACAGGTCCGGGTCTCCCTCTTCCACACCCCGGACCTCCGCGGCCTGCTCCGGCTCCTGGTCCCGGAGCGCCTCAATGAGACCATCGGCCTCCAGCACATTAAAGTGTACCTCTTTGACAACAGTGTCATCTTGAGCGGCGCCAACCTGAGTGACTCCTACTTCACCAACCGCCAGGACCGCTACGTGTTCTTGCAGGACTGTCCCGAGATCGCGGACTTCTTCACGGAGCTGGTGGACGCCGTGGGGGACGTGTCCCTGCAGTTGCAGGGGGATGACACGGTGCAGGTGGTGGAGGGTATGGTGCATCCTTACAAAGGTGACCGGGCTGCATACTGCAAGGCAGCCAACGAGCGGGTCATGGGTGTGGTCAGCTCGGCCCGGGCCCGCCAGCAAGCGCTGCATGCCCAGACTTTCCACAGCGACTCCCTGTTGACCCAGGAAGACGCAGCAGCCGCTGGTGACCGGAGGCCAGCCCCCGACACCTGGATTTACCCTCTGATACAGATGAAGCCCTTCGAGATCCAGATCGACGAGATTGTCACCGAGACCCTGCTGACAGAGGCTGAGCGCGGCGCCAGGGTCTACCTTACCACCGGCTACTTCAACCTGACCCAGGCCTACATGGACCTGGTCCTGGGCACGCGGGCTGAGTACCAGATCCTGCTGGCCTCCCCGGAGGTGAACGGTTTCTTCGGGGCCAAGGGGGTGGCGGGCGCCATCCCAGCGGCCTACGTGCACATCGAGCGGCAGTTCTACAGTGAGGTCTGCAGCCTCGGGCAGCAGGAGCGGGTCCAGCTGCAGGAGTACTGGCGGAGGGGCTGGACATTTCATGCCAAAGGTCAGTCCACCGGGACCTGGAGGCCCAGATCGCCATCGTGACGGAAAACCGGGCCCTGCAGCAGCAGCTTCACCAGGAGCAGGAGCAGCTCTACCTGAGGTCAGGTGCCGTGTCCGCCGCCACCTTCGAGCAGCCGAGTCGGCAGGTGAAGCTGTGGGTGAAGCTGGTGACTCCGCTGATTAAGAACTTCTTCTGAGGATGACAGGGATGGCCTTGACGAAGATGACGGGCATGGCTGGCGTCAGCTCCTTCAGCCGCGCTTCGGCGATGACCCCGGTCTGGGTGTCCCAGCGAGCTCCTGCAGGGACAGTGCCGCAGTGAGGGCCGGCATGGCCCGGAAGCGACAGGAGCCCGGCCTTGATCCCCACCTCTGCAGAGACAGGTTGGTGCCCGAGTCCGCCGGCTCGGCTCCGCCCCCGGAGAGCTCAGGCCAGGTGCCGGGGCTGGACTGGCACAGGGATGCTGACGATGGACTCGCACACGGGGACCGGGCGGTAATGAGGCGCTGCCGTGTGCCGCGGCCCGCCGGCTCCATGTTGCATTCGTGGGGTTTCAGCGCCATCCGCCAGCCTTCCTAGCTCACTCCACTTTATGACTCCACTAAGTAGCAGCAGGAGGCGGGGCCTGTGTGCACACGCGCAGTGTGACTCTGCGTCCTCACGCACGTGCGACTGCTGTCTGCTCTAACTGGGCTGCTCTTGTTTCTACTCATCCTATTTAATGACGTTAATGTTTCCTGTCTAATTTCAAAA