Transcript asmbl_66485

Sequence
Transcript Sequence for observation asmbl_66485 of TGE0007360:
AGCAGCAGCAGCAGCAGCCGCCGCACCACCACCACCATTATTATTACTACAACCACAGCCACAACCACCATCACCACCACCATCACCAGCAGCCTCACCAATACCTGCAGCATGGAGCCGAGGGCAGCCCCAAGGCCCAGCCAAAGCCGCTGAAACATGAGCAGAAACACGCCCTCCAGCAGCACCAGGAAACGCCGAAGAAGAAAACAGGCTATGGTGAACTAAATGGTAATGCTGGAGAAAGAGAAGTATCTTTAAAGAACCTGGGTTCTGATGAAGCTACCAGCCCAATTTCCAGGGTCCTCAATGGCAACCAACAAGTTGTAGACACTAATCCGAAGCAGACTGTAAAGACCAGCACCTTTGGGAAAGCAGGAATTAAAACCAGGAATTTCATTCAGAAGAACAGTATGGACAAAAAGAATGGAAAGTCTTATGAAAATAAATCTGGAGAGAACCAGTCTGTAGATAAGAGTGATGCTGTAGCAATTCCAAATGGTGTTGTAACAAATAATTCTGGCTATATTACTAATGGTTATATGGGCAAAGGAGCAGATAATGATGGTAGTGGATCTGAGAGCGGATATACCACTCCTAAAAAAAGGAAAGCTAGGCGCAATAGTGCCAAGGGTTGTGAAAACCTTAATTTAGTGCAGGACAAAATAATGCAACAAGAGACCAGTGTCCCAACCTTAAAACAGGGACTTGAAACTTTCAAGCCTGACTATAGTGAACAAAAGGGAAATCGAGTAGATGGTTCAAAGCCCATTTGGAAGTATGAAACTGGGCCTGGAGGAACAAGTCGAGGAAAACCTTCTGTGGGTGATATGCTGCGGAAAAGTTCTGATATTAAACCTGGCGTGAGCAGCAAAAAATTTGATGACCGGCCCAAAGGAAAGCATGCTTCTGCTGTTGCCTCCAAAGAGGACTCATGGACCCTATTTAAACCACCTCCAGTTTTTCCAGTAGACAATAGCAGTGCTAAAATAGTTCCTAAAATAAGTTATGCAAGCAAAGTTAAGGAAAACCTCAACAAAACTGTACAGAACTCTTCTGTGTCACCATCTTCATCTTCATCCTCTTCATCATCTGTTGGGGAAACTCAGACCCAATCTTCAAGTCGGTTATCCCAGGTCCCTATGTCAGCGCTGAAATCTGTTACTTCAGCCAGCTTTTCTAATGGACCTGTTTTAGCAGGGACTGATGCAAGTGTGTATTCTCCAGGGGGTCAGCCACTGCTAACTACTGCTGCTAATACGCTAACACCCACCTCTTCTGGGACTGATTCAGTTCTCCAGGACATGAGTCTGACTTCAGCAGCTGTTGAACAAATTAAGTCTAGCCTTTTTATCTACCCTTCAAATATGCAAGCTGTGCTGTTGAGCACAGCACAAGTGGATCTACCCTCTCAGACAGATCAGCAAAACCTGGGGGATATCTTCCAGAATCAGTGGGGTTTATCATTTATAAATGAACCCAGTGCTGGCCCTGAGACTGTTACTGGGAAGTCATCAGATAAAGTGATGGAGGTGACATTTCAAGGGGAATATCCTGCCACTTTGGTTTCACAGGGTGCTGAAATAATCCCCTCAGGAACTGAGCATCCTGTGTTTCCCAAGGCATATGAGCTGGAAAAACGGACTAGTCCTCAAGTTCTGGGTAGCATTCTAAAATCTGGGACTACTAGTGAGAGTGGAGCCTTATCCTTGGAACCCAGTCATATAGGTGACCTGCAAAAAGCAGACACCAGTAGTCAAGGTGCTTTAGTGTTTCTCTCAAAGGACTACGAGATAGAAAATCAAAATCCTCTGGCATCTCCTACGAACACTTTGTTAGGCTCCGCCAAAGAACAGAGATACCAGAGAGGCCTAGAAAGGGATGATAGCTGGGGTTCTTTTGACCTGAGGGCTGCTATTGTATATCACACTAAAGAAATGGAATCTGTTTGGAATTTGCAGAAGCAAGATCCCAAAAGGATAATCACTTACAATGAAGCCATGGATAGTCCAGATCAATGAAGGACCAGACTGCCTATTTGTAACCTTCCTGCAGCATTAGAGCCACCGTTCATGGGGGACACAAGGCTTTTATGCTCCTAGATCTTCAACGCAGCAGAGGAACCATAAGTAGAATCACAGGATAATATATACATATATATATATACATATATAT