Transcript asmbl_65990

Sequence
Transcript Sequence for observation asmbl_65990 of TGE0031256:
GTGAGCAGATATGACCAAAAATTGTGTTTGGTTTCCAGACCTGACATCCATAGGCTGACTGACAGACTGAAGAATCTAGGGGCTGAGTATGTAATCACAGAAGAAGAGCTAAGAAAACTTGAGCTGAAAAACTTCTTTAAGGATGTGCCCCGGCCCCGGCTTGCTCTCAACTGCGTCGGTGGGAAAAGCTCCACCGAGCTGCTGCAGCGCTTGGCGCCCGGAGGAACCATGGTGACCTACGGGGGCATGGCCAAGCAGCCCGTCATCGCTTCTGTGAGCGTGTTCATTTTTAAAGATGTCAAACTTCGGGGCTTTTGGCTATCCCAGTGGAAGAAGGACCACAGTACAGACCATTTTAAGGAGCTGATCCTTACACTGTGCCACCTCGTCCACCAAGGCAAGCTCACAGCCCCCACCTGCTCCGAGGTCCCACTGCAGGACTACAACCATGCCTTGGAAACCGCAATGCATCCCTTCACATCGTCAAAGCAGATTTTCATCATGTGATAATAATCCCAGAGGAGCCAGAGCAAAGTGCGGGGCAGGGGGCAGAAGGGTG