Transcript asmbl_17893

Sequence
Transcript Sequence for observation asmbl_17893 of TGE0000470:
AGGTAGAATTGGGCTATTTGCTGAAGCTTCTTGGTGGCCCTTGCTAGCCCAGGAAGAAACTTACATTTTGATTTTTTTGTACCATGGCTTTGGTTCACAAATTGCTGCGTGGTACTTATTTTCTCAGAAAATTCTCTAAGCCAACTTCTGCCTTGTATCCATTTTTGGGTATTCGCTTTGCAGAGTATTCCAGTAGTCTTCAGAAACCAGTGGCTTCTCCTGGCAAAGCCTCCTCACAGAGGAAGACTGAAGGGGATTTGCAAGGAGATCACCAGAAAGAAGTTGCTTTGGATATAACTTCTTCTGAGGAGAAGCCTGATGTTAGTTTCGATAAAGCAATTAGAGATGAAGCAATATACCATTTTAGGCTTTTGAAGGATGAAATTGTGGATCATTGGAGAGGACCGGAAGGCCACCCTCTGCATGAGGTCTTGCTGGAACAAGCCAAGGTTGTCTGGCAATTCCGGGGGAAAGAAGATTTGGATAAGTGGACAGTGACTTCTGATAAGACGATTGGAGGCAGAAGTGAAGTGTTTTTGAAAATGGGCAAGAATAACCAAAGTGCACTGCTATATGGAACTCTGAGCTCTGAGGCGCCTCAGGACGGGGAGTCTACCCGAAGTGGGTACTGTGCAATGATATCCAGGATTCCAAGGGGTGCTTTTGAGAGGAAGATGTCTTACGATTGGTCCCAGTTCAATACTCTGTATCTCCGTGTACGTGGGGATGGTCGGCCTTGGATGGTGAATATCAAGGAGGACACAGATTTCTTCCAGAGGACGAATCAGATGTATAGTTACTTCATGTTCACCCGCGGGGGACCCTACTGGCAGGAGGTCAAGATTCCTTTTTCCAAATTTTTCTTCTCTAATCGAGGAAGAATCCGGGATGTTCAGCATGAGCTTCCGCTTGATAAGATCTCTTCTATAGGATTCACCTTGGCTGATAAAGTGGATGGTCCATTCTTCCTGGAGATAGATTTTATTGGCGTGTTTACTGATCCAGCTCATACAGAAGAATTTGCCTATGAAAATTCTCCAGAGCTTAACCCAAGGCTTTTTAAATAAAGATCATATGGTAGTTTTGTTTTACTAATCTAAGGGTACTAGCATCTACAATGATATAGACAAAATAAAATATTTCTTTAATGGCA