Transcript asmbl_65984

Sequence
Transcript Sequence for observation asmbl_65984 of TGE0031252:
CTGAAGCGAGCATGTGGGTCTGCTGCGCGCTGCGCTGGTCGCGAACCGCGGCCCGGCTGCGGCCGGGGCTGCTGCTCTCTGCGGGCCGCTGCTCGCCTGCGGCCGCCTCCTACTCTGCTTCTGCCGAGCCCTCCCAGGTCCAGGCGCTGGTCTACGAGCACCACGGGCACCCAACCAAGGCCATCGAACTGAAGAACCTGGAGCTAACTGCTGTGGGCGGATCAGATGTCCATGTGAAGATGCTGGCGGCCCCTATCAATCCATCTGACATAAATATGATCCAAGGGAATTATGGCTTCCTTCCCAAGCTACCTGCCATTGGAGGAAACGAAGGCGTTGGACAGGTGGTCGCAGTGGGCAGCAGTGTGACTAGGGTGAAGCCAGGAGACTGGGTGATTCTAGCACATGCCGGTTTGGGAACCTGGCGGACCGAGGCTGTGTTCAGCGAGGAAGCACTGATCAGAGTTCCGAGTGACATCCCTCTTCAAACTGCTGCCACCCTGAGTGTCAATCCCTGCACAGCCTACAGGATGTTGATGGACTTTGAGCAGCTGCAGCCAGGGGATTCTGTCATCCAGAATGCATCCAACAGTGGAGTAGGGCAAGCAGTCATCCAGATCGCCGCAGCCCTGGGCCTGAGGACCATCAATGTGGTCCGAGACAGACCTGACATCCATAGGCTGACTGACAGACTGAAGAATCTAGGGGCTGAGTATGTAATCACAGAAGAAGAGCTAAGAAAACTTGAGCTGAAAAACTTCTTTAAGGATGTGCCCCGGCCCCGGCTTGCTCTCAACTGCGTCGGTGGGAAAAGCTCCACCGAGCTGCTGCAGCGCTTGGCGCCCGGAGGAACCATGGTGACCTACGGGGGCATGGCCAAGCAGCCCGTCATCGCTTCTGTGAGCGTGTTCATTTTTAAAGATGTCAAACTTCGGGGCTTTTGGCTATCCCAGTGGAAGAAGGACCACAGTACAGACCATTTTAAGGAGCTGATCCTTACACTGTGCCACCTCGTCCACCAAGGCAAGCTCACAGCCCCCACCTGCTCCGAGGTCCCACTGCAGGACTACAACCATGCCTTGGAAACCGCAATGCATCCCTTCACATCGTCAAAGCAGATTTTCATCATGTGATAATAATCCCAGAGGAGCCAGAGCAAAGTGCGGGGCAGGGGGCAGAAGGGTG