Transcript asmbl_28433

Sequence
Transcript Sequence for observation asmbl_28433 of TGE0004615:
GCGGTCGCGTTGGCTGCGCGGGTTGCGGACGGTGCTTTGAACCCGGGGCGGGGGCGGCGGCGGGAGCCGAGGTCGGGGTCGGGATTAGTGTCCGCGTCTGGATCCGGCCCGGGCCGCCGGCACTCCTGGGCGTCCGCTTCCGGGCATGGCGGCCGAGGTGCGCGTTTCGCGCTGGTACTTCGGGGGCCTGGCCTCGTGTGGGGCAGCCTGCTGCACGCACCCGCTGGACCTGCTCAAGGTGCACCTGCAGACGCAGCAGGAGGTGAAGCTGCGCATGACCGGCATGGCGCTGCAGGTGGTGCGCTCCGACGGCATCCTGGCGCTCTACAACGGCCTGAGCGCCTCCCTGTGCAGACAGATGACCTACTCCCTGACCCGATTCGCCATCTACGAGACCGTGCGTGACCAGGTGGCCCAGGGCAGCCAGGGGCCCCTGCCCTTCTACAAGAAGGTGTTGCTGGGTTCCCTCAGTGGTTGCATCGGAGGTCTCGTGGGGACTCCCGCTGACATGGTCAACGTCAGGATGCAGAACGACATGAAGCTGCCCCAGGATCAGCGCCGAAACTACGCGCACGCCCTGGACGGCCTGTACCGTGTGGCCCGAGAAGAGGGTCTGAAGAAGCTGTTCTCGGGTGCGACCATGGCGTCTAGTCGAGGGATGTTGGTGACCGTGGGCCAGCTGTCCTGCTATGACCAGGCCAAGCAGCTCGTCCTCAGCATGGGGTACCTGTCTGACGGCATCGTCACTCACTTCATCGCCAGCTTCATCGCAGGTGGGTGTGCCACGTTTCTGTGCCAGCCGCTGGACGTGCTGAAGACCCGTCTGATGAACTCCAAGGGCGAGTATCAGGGCGTTCTCCACTGCACCATGGAGACTGCGAAACTCGGGCCAATGGCCTTTTACAAGGGCCTCTTGCCCGCCGGCATCCGCCTCATGCCCCACACCGTGCTCACGTTCGTGTTTCTGGAACAGCTTCGCAAACACTTTGGCATCAAAGTGCCGTCCTGATGGGGCCGTGGGAGCGAGCTGGGCCGTGCTGGCCCCCAGTGCCAGTTCTTCCACAGTCCCGGCAAGCCAAGCGCTGCCCTAAGCCCAGCACCTGCCCGCAGGGCTCCAGCCCCCCATTCCTGGCCCAGGACGCCCACCCCGTCCTCCCCCACCTGCCTGGGCTGGAGCTCCTTCCAGGAGCTGTCCCCCCAGCACCCCTCCGCTGTAGCTTCGCCTTGGCCCTCCCTACCTGGCACCCCAGTGGCCCCATCCACGCACCTGTGCCTCACTGGGAGGGGCGGGCTCCAAGTGCAGGTTCAGGCTTCTCCCCTCCCCGAGCAGTCAGCCCTGGCGGGGGAGGGGCAGGCTCCAGGCTTTCTGGGGTCCCCCGCCCCTTCGCCTGAGGCGTTTCTTTCACCGAGCAGCTGCCCAGGGCTCACAGCACCGTCTTCCAGCAGCTTCTTTCAAGGACCTGGGAGGCAGAGCGGGGGGAGTGCAGACCCCCAGCATTGCCCACCAAAGCGTGTGCCTGCACGCGCACTTTATCCTAGGAAAGGGACCATAGCTTTCGTGACGTTCTCGAAGGTAGCTGTGCCCCTGCGCTGCTGGGCAGGTGGCGGAGGAGGCAGGGAACGCAGGGTCTGAGCTGTGGGCCCCTCAGGCCCGTCCCGCCCCAGCCAACCCCCTGTTGCTCTAAGGGTTAGTTTCACCAAAAACCTCAGCGCCAGAGGCGCTGCTGTCTGCAGGGAGCGGAGTGTCTCTCACACCGTCCACGCTGTCCCCTCCGGCCCCCGGGGCAGAGGCGGGCTGTGCCGCGTCCTCGGGGCCCCTCTCTCTGTGGACAGCGATCACCCTTCAGGGCCCCCAGCAGCTGACCAGCCAAAACACCGCCGCCCAGGTTCTGCTGCCAGAGCAGCCTGACCCTGCAAATGGGCCTAGGGACTGTGTCTTCACCCCGGTAGGGGGCCGGCCCACAGGGACACTAATAAAGGACAGGAGCTGC