Transcript asmbl_6566

Sequence
Transcript Sequence for observation asmbl_6566 of TGE0007115:
AACGACTGAGAGAAGGATCAAGGAAACAACTGAGGAGAATTTAGGGGCAGGTTATGCGACGTGGAAATGGGGGCATAGGTTTCTGGGGAGGGCACACACGGAGTGGCGTCTTGCATCTCTCGGTAGATTCCAGAATCCTCCGCTATTCAGGACCGTGCAGGAAGACCATGCCGAGACCCAAGAAGAGGATGGCTGGGGCTGCTGAGCCAGACAAGAAGGGACCAGCAGGAAAACGTCCCAAGATTAAGAACCTAGGTGAGACATCAACTAAAGTGGAGAACTCCAGCCCTCAGAAGACTTCAACCTCTAAAAATTGCACGAAAAATCTAAGCAGCTATTGGCTGATGAAGTCAGAGCCAGAAAGCCGTCTAGAGAAAGGTGTAGATGTGAAGTTCAGCATTGAGGATCTCAAAGCACAGCCCAAGCAGACAGCATGCTGGGATGGTGTCCGCAACTATCAGGCTCGGAACTTCCTTAGAGCCATGAAGCTGGAGGAAGAAGCTTTCTTCTACCATAGCAACTGCAAAGAGCCAGGCATTGCCGGACTTATTAAGATTGTGAAGGAGGCTTACCCAGACCACACACAGTTTGAGAAAAGCAATCCCTATTATGATCCCTCCAGCAAAGAAGACAACCCCAAATGGGCCATGGTGGATGTACAGTTTGTTCGGATGATGAAGCGTTTCATTTCCTTGGCGGAGCTCAAAACCCATCACCAAGCTCACAAAGCCACTGGTGGCCCCTTAAAAAATATGGCACTCTTCACTCGCCAGAGACTCTCAATTCAGCCCCTGACCCAAGAAGAATTTGATTTTATTTTGAGCCTGGAGGAAAAGGAACCAAGTTAACTGATACGCTGGAATGGGCAAGACATTATTCCAAAGGAGTGAAGCTTTTATAAGACAAAAGGTGTGAGGAGGCTTGCTTGTTATGTTCATTGGGGTTTGTGTACATAGGTGGGTTTTGTGTACTTTCTCAATAAAATGCTAATATCAA