Transcript asmbl_65657

Sequence
Transcript Sequence for observation asmbl_65657 of TGE0007233:
CGCGCTGTCGGGCGGGGGCGAGGTTCGGGCCGGTTGTGCCGTTGCGAGACTGCAGCTGCGATCGCTGCGGTGGGCCCAGAATTGTATCCTGACCGTAAATCGGAGAAGCCAGCAGCACTGCCAGTGTTCCTTTGAGGTAGTGTCTGGGATCCGGTGCAAGTTGAATCATTGTTCAAATAAGGTGTAATTGAAAAGTGACTGACCCTCTCTTCAGAGATGTCAAAAACAAACAAATCCAAGTCTGGATCTCGTTCTTCTCGCTCGAGGTCTGCATCAAGATCTCGTTCTCGTTCATTTTCGAAGTCTCGATCTCGAAGTCGATCTGTCTCTCGTTCAAGGAAGCGCAGGCTGAGTTCTAGGTCTCGTTCCAGATCATATTCTCCAGCTCATAACAGAGAGAGGAATCATCCAAGAGTATATCAGAATCGGGATTTCCGAGGGCACAACAGAGGTTATAGAAGGCCTTATTATTTCCGTGGGCGCAACAGAGGCTTTTATCCGTGGGGCCAGTATAACCGAGGAGGTTATGGAAACTACCGCTCAAATTGGCAGAATTACCGGCAAGCATACAGTCCTCGTCGGGGCCGTTCCCGATCCCGGTCCCCAAAGAGAAGGTCCCCTTCGCCACGGTCCAGGAGCCATTCTAGAAACTCCGATAAGTCTTCTTCTGACAGGTCAAGGCGCTCCTCATCCTCTCGTTCTTCCTCCAACCACAGCCGAGTTGAATCTTCTAAGCGCAAATCTGCAAAGGAGAAAAAGTCCTCTTCCAAGGATAGCCGGCCGTCTCAGGCTGCTGGGGAAAACCAGGGAGATGAAGCCAAGGAGCAGACGTTCTCTGGAGGCACTTCTCAAGATTCGAAAGCATCTGAAAGCTCTAAGCCATGGGCAGATGCCAGCACATACAGTGCTGGTTCTGCATCACGGGCCTCGGCAGTTTCCGAGCTGAGTCCCCGGGAGCGAAGCCCTGCTCTGAAAAGCCCCCTCCAGTCTGTGGTGGTGAGACGGCGGTCTCCCCGTCCCAGCCCTGTGCCCAAACCTAGCCCTCCACTTTCCAGCACATCCCAGATGGGTTCAGCTCTGCAGAGTGGTTCTGGGTACCAGGCTGGGACACACCAAGGTCAATTTGACCATGGCTCTGGGTCCTTGAGTCCATCCAAAAAGAGCCCTGTGGGTAAGAGTCCACCAGCCACTGGCTCCACATATGGCTCGTCTCAGAAAGAGGAGGCCGCTGCTCCAGGAGGAGCAGCCTATACAAAGAGGTATCTAGATGAACAGAAGACAGAGAATGGAAAAGATAAGGAACAGAAACAAACAAATACTGATAAAGAGAAAATGAAAGAGAAAGGGAGCTTCTCTGACACAGGCTTGGGTGATTCGAAAATGAAATCTGATCTGTTTGCTCCCAAAACTGATTCTGAGAAGCCTTTTCGGGGTAGCCAGTCTCCCAAAAGATATAAGCTCCGAGATGACTTTGAGAAGAAGATGGCTGACTTCCATAAGGAGGAGATGGATGATCAAGACAAGGACAAAGCTAAAGGAAGGAAGGAATCTGAGTTTGATGATGAACCCAAATTTATGTCGAAAGTCATCGCAGGTGCAAACAAAAACCAGGAGGAGGAGAAGTCAGGCAAATGGGAGGGCCTGGTATATGCACCCCCAGGGAAGGAAAAGCAGAGGAAAACGGAGGAGCTGGAGGAGGAGTCTTTCTCAGAGAGATCCAAAAAGGAAGATCGGGGAGGGCCCAAGAGAACCGAAAGTGGGCACAGGGGGTTTGTGCCTGAAAAGAATTTCCGAGTGACCGCTTACAAAGCAGCCCAGGAGAAAAGTTCATCTCCTCCCCCAAGAAAGACCTCGGAGAGCCGAGAGAAGCTGGGAGCCAAAGGAGACTTTTCCACAGGGAAGTCATCCTTTTCCATTACTCGAGAGGCCCAGGTCAATGTCCGGATGGATTCTTTTGATGAAGACCTTGCAAGACCCAGTGGGTTATTGGCCCAGGAACGCAAGCTTTGTCGGGATCTAGTCCATAGTAACAAAAAGGAACAGGAATTTCGTTCCATTTTCCAGCACATACAGTCAGCTCAGTCTCAGCGGAGCCCCTCAGAACTCTTTGCCCAGCACATAGTGACCATTGTTCACCATGTAAAAGAGCATCACTTTGGGTCCTCAGGAATGACATTGCATGAACGCTTTACTAAATACCTAAAGAGAGGAACTGAGCAGGAGGCAGCTAAAAACAAGAAAAGCCCAGAGATACACAGGAGGATAGACATTTCCCCCAGTACATTCAGAAAACATGGTTTGGCTCATGATGAAATGAAAAGCCCTCGGGAACCTGGCTACAAGGATGGGCATAATTCTAAAAATGAACTACAAAGGGTTAATTTTTATTAAATGTATCAACAACCTTTGTGAAGTGGTTAGAATATGGTAAATGACCCCAAAGTCTATTGAGGTGAGCTTGAGAAAAAAAAGAGAGGAGTTTTGGAACAAGTGCCCATGATGAGAGAAGAAACTTTTTGTGATATTTTTCTGCTTGCTGAGGGAAAATACAAAGATGATCCTGTTGATCTCCGCCTTGATATTGAACGGCGTAAAAAACATAAGGAGAGAGATCTTAAACGAGGCAAATCAAGAGAATCGGTGGATTCCAGAGACTCAAGCCACTCGAGGGAAAGATCAGCTGAGAAAACCGAGAAACCCCATAAAGGATCAAAGAAGCAGAAGAAGCACCGGAGAGCACGAGACCGGTCCAGGTCATCATCCTCTTCCTCCCAGTCATCCCACTCCTACAAAGCGGAGGAGTACACTGAAGAGACGGAGGAGAGAGAGGAGAGCACCACGGGCTTTGACAAATCGAGACTGGGGACCAAAGACTTCGTGGGTCCAAGTGAAAGAGGCAGAGCTCGAGGGGCCTTTCAATTTCGAGCCAGAGGGAGAGGCTGGGGCAGAGGCAACTACTCTGGCAACAACAACAGCAGCAGCAACAATGATTTTCAAAAGAGAAACCGGGAGGAGGAATGGGACCCTGAGTACACACCGAAAAGCAAGAAGTATTACCTGCATGACGACCGGGAAGGAGAAGGCAGTGAGAAGTGGGTGAGCCGGGGCCGTGGCCGAGGAGCCTTTCCCCGAGGTCGAGGCCGGTTCATGTTCCGGAAATCCAGCACCAGCCCTAAATGGGCCCATGACAAGTTCAGTGGGGAAGAAGGCGAGATTGAAGATGACGAGAGTGGGACAGAGAACCGAGAAGAGAAGGACAATTTACAGCCCACCACTGAGTAGGGGCCACTCTCATGAGAACCCTTGCCCAGGGGAACAGAGGCGCTGGGAAGATGGCTGGTGAAAAGCTAAACAGATGAGCCCCAAGAAGATTCTGATGAGCCCCAACCCTACCCCCCACCAGCCATGCAGAATCCTACTACAGCCAAAAGCATCCTTGGCGCTGTGTCCCACTGGACAGAGGTGGCCGGCCATGGAGCCTGGGGTCAGGCCCAGCTCTTGAGCAGAATACAACACTTTGGGCTTTAGCTGTGTTTCTCATTTGTTGTTGGTGTGTGGGGTGGGGGCTGGGGTAGGGAGGGGAG