Transcript asmbl_64653

Sequence
Transcript Sequence for observation asmbl_64653 of TGE0007200:
CGCCTCTAGAGCCTCCAGAGCCCGCGGGGCTATTCCTCTTCCGGGGCAGCGCGGGGACGCGTGTAGGACCCGGATGCAGACGCGAGCACAGGTTTATAAGCGCCACGCAGGCCACGGTCCCTTCTTTTGGAGGAAGACGCGGTAGCAGCTTCAGCTGCGTTTCGTCTTGCTCGCTGTTGCTCCTGACTCACCGCTGTTCGCTCTCGTGGAGGAACAAGTCGGTCAGGAAGCCGCGCTGCAGCCATGGCCTTTAAAGATACCGGAAAGACGCCCGTGGAACCAGAGGTGGCGATTCACCGAATTAGAATTACTTTGACCAGCCGCAACGTAAAATCTTTGGAGAAGGTGTGTGCTGATTTGATCAGAGGTGCGAAGGACAAGAATCTCAAAGTGAAAGGACCAGTTCGGATGCCCACCAAGACTCTGAGAATCACTACAAGAAAAACTCCCTGTGGAGAAGGTTCTAAGACTTGGGATCGTTTTCAGATGAGGATCCACAAGCGACTCATTGACTTGCACAGCCCTTCTGAGATTGTTAAGCAGATTACTTCCATCAGTATTGAGCCAGGAGTTGAGGTTGAAGTCACCATTGCAGATGCTTAAATCAGACTTTTTAATAAATTGACTATCAGTTAAATTTTGTTGACTTTTATTTGCAGTAATGGCACATTTTAAGACTATAAATTTAGACTGAATTTACTTTCAAGTAGAATAATCAAAATTAGTTGGATATGCTGTGGTAACCTGTCCTGTTTTCATTATATTCTGTTGTAGAGTCTGCTAAACCAGTTTATACTTGGAATCACAGGACAGCTGGGTTCTGTTAACTAAATACATGAGACCTGACCGTTGATGAATGTATAGTGTGGTGGCTTTATAACTGGCTGCATATTGGGGCTTTTTCAAAGAATGCATGTCTGGGTCCTATCACAAGAAATTCTGACAATTGATTTGGGGTTCTGTCCTATAACACAAACAGTTTCTGGGGTGATTCTGAAGTTCTATGACTGGTTTAGAGCCTGGCGCGTTAGAGGACAAGTAACTGGGAAAACAAGTTCTACCCCTGGCTCTGCAAATAAAGTCATCCCTCCTTTTTAGAAGATACATAGCTAAAGAGTAAACAAGGCAAATTTTAACAGGTTTTGGCAACATCGGTTTTACATATATTTTAGATTAAAAGGTAAAAGTAAATACTAGTACTTTGCTGATAGGTTGTATCTAGACTTGTATTTTATATACATTACTTGGAATTTTAACAATGTGTAGGTTATTCACTATGAAATTCTTAACTTTAGGACTGAAAAGCATGTCACATAGGCCAAATTCATTCAGCAAAACTTCTGTTGGCACAGTGAATAATATTAACTACCAGGTTGTATGCTTAAATGCTTTATTTTGTT