Transcript asmbl_64307

Sequence
Transcript Sequence for observation asmbl_64307 of TGE0007193:
AGCTCAAGAGATGGCTGCCCAGTGTGTGACAAAGGTGGAGCTGAATATTTCCTGCGACAATCTTCTGGATAAAGACATAGGGTCCAAGTCGGACCCGTTATGCGTGTTATTTTTGAATACGAGCGGCCAGCAGTGGTATGAGGTTGAGCGCACAGAAAAGGTCAAGAATTGCTTGAATCCCACATTTTCCAAGACTTTCATTATTGATTACTACTTCGAAGTGGTTCAGAAATTGAAATTTGGGATTTATGACATCGACAACAAGACTATAGAGCTGGGCGATGATGACTTCTTAGGAGAATGTGAATGCACCCTTGGACAAATTGTTTCCAGTAAGAAGCTGACCCGACCCCTGGTGCTTAAGAATGGCAGACCTGCGGGGAAAGGCAGCATCACGATTTCGGCTGAAGAGATAAAGGATAACAGAGTCGTCTTGTTTGAAATGGAAGCCAGGAAACTGGATAATAAGGATCTCTTTGGGAAGTCAGATCCGTACCTGGAATTCCACAAGCAGACATCTGATGGCAACTGGCTCATGGTTCACCGGACAGAGGTTATTAAAAACAACTTGAATCCTGTTTGGAGGCCTTTTAAAATCTCCCTTAACTCCCTGTGCTATGGAGATATGGATAAGATTATCAAGGTAGAGTGCTATGACTACGATAACGATGGGTCACATGATCTCATTGGAACATTCCAAACCACCATGACGAAACTGAAAGAGGCCTCCAGGAGCTCGCCTGTTGAATTTGAATGCATAAATGAAAAGAAGAGACAGAAGAAGAAAAGCTACAAGAATTCCGGTGTCATCAGTGTGAAGCAGTGTGAGATTACAGTGGAATGCACATTCCTTGACTATATCATGGGAGGCTGTCAGCTGAATTTTACTGTGGGGGTGGACTTCACTGGCTCCAACGGTGACCCACGGTCTCCTGACTCCCTTCATTACATCAGCCCCAACGGCGTGAATGAGTACTTGACCGCCATCTGGTCTGTGGGGCTGGTCATTCAGGATTACGATGCTGATAAGATGTTTCCAGCCTTTGGGTTCGGAGCTCAGATTCCTCCTCAGTGGCAGGTGTCGCACGAATTCCCCATGAGCTTTAACCCGTCCAACCCCTACTGTAATGGAATCCAAGGCATTGTGGAGGCATATCGGGCCTGTCTTCCTCAGATAAAACTCTATGGACCAACAAATTTTTCTCCCATCATCAATCACGTGGCCAGGTTTGCTGCCGCAGCCACACAGCAGCAGACAGCTTCTCAATACTTCGTGCTGCTCATCATCACCGACGGTGTGATCACGGACCTGGACGAGACCAGACAGGCGATCGTCAGCGCCGCCAAGCTGCCCATGTCCATCATCATCGTTGGCGTCGGCGGCGCTGACTTCAGCGCCATGGAGTTTCTGGACGGTGACGGTGGGGGCCTGCGCTCCCCGTCAGGGGAGACTGCCATCAGGGACATCGTGCAGTTCGTGCCTTTCAGGCAGTTCCAGAATGCTCCCCGAGAAGCGCTGGCTCAGTGCGTCCTGGCGGAGGTCCCCCAGCAGGTGGTGGGCTACTTCAATACCTGCAAGCTCCTGCCCCCCAAGAACCGCACCGCCCAGTGAAAACGCTCCTGCGCCGCACTGCGGGCTGCCCGTTTCCCACGCTCCCCAGCATCCGTGACGGAAACCGAGTCCCCGTGGACTGCGTCTCCTTAAAGCATTCTTTTATACTTTTCTTGGAAGAAAGTGCTAACTTAACCTTTGTCCAATCAATTCAGTGATTGCTAGTGATTAGAGACTCGCACGAGGAAAGCCGCCTTTGCCATGGTGATTGTTTGCTCTCACAGGATGAAGATGCTGGTTGGAACATTCGTCAGTAGAGAGGATGAAGACTTGTTGGGGGTGGGGGAATTTCAGGCCGCTGTGCTTCGTCGGCTCGAGGCCACATGTGCTACAAGTCAGTGTCCGTCCCCGGTGACGGGCGCTTCTCAAAGCAGACGTGCTGAACCTGTCCCTGCAGTTGCTGAGTGCCTGACCCTTGCCCAAGTCTCGCTGCGGCTTAGCCACAGCACAGCTCGCCCCAGCAGCACCCCAAGACTCTCCGAAGAGCGCAGACGAGGACAGGCACCCTTGCACTTCTCAAAAGGAAGAGGAGCCTCAGGAACGTGCGCGGCTGTTCCCGTGTGCCTTTCCAGGACCCGTGTCTGCACGGAGGGCAGGCCGACCGGGCTCAGCGTCAGTAGCGTTTTTTAATTGGAGTTTGTCAGAATGGTTACGACTGCCTAGTCCAGGAAAGCTACGAGGACCAGACGTGTAGAGAAAACTGAGAATCCCTTCCCTTTTAGCCAATGAAGACTTTACTTACTAAGAAAGGACAATTTTTATCCTTGCTGAGGTCCTATACATTGATTAGTACATTTCTTCACATTCGTGTAGACATTTTTTCCTGTTTTCTTTAGTTACTCTTTTAGTCTGGTTTTTAAACTCATGATAGTGGTTGTCTATTAATCAAAATCATATTTTGCAT