Transcript asmbl_64077

Sequence
Transcript Sequence for observation asmbl_64077 of TGE0000273:
AGGTACTAGCTTTTGACAAGTTTGCACCATGCGTGAATATAAGCTAGTCGTTCTTGGCTCAGGAGGCGTTGGAAAATCTGCTCTGACTGTACAGTTTGTTCAAGGAATTTTTGTTGAAAAATATGATCCTACGATAGAAGATTCTTATAGAAAGCAAGTTGAAGTAGATGCACAACAGTGTATGCTTGAAATTTTGGATACTGCAGGAACGGAACAATTTACAGCAATGAGGGATTTGTACATGAAAAATGGACAAGGCTTTGCGTTAGTTTATTCCATCACAGCACAGTCCACATTTAATGATTTACAAGATCTGAGAGAACAGATTCTTCGAGTTAAAGACACTGATGATGTTCCAATGATTCTGGTTGGTAATAAGTGTGACTTGGAAGATGAAAGAGTTGTAGGAAAGGAACAAGGTCAGAATCTAGCAAGACAATGGAACAACTGTGCATTCTTAGAATCCTCTGCAAAATCAAAAATAAATGTTAATGAGATCTTTTATGACCTAGTGCGGCAAATTAACAGAAAAACTCCAGTGCCTGGGAAGGCCCGCAAAAAGTCATCATGTCAGCTCCTTTAATATACTAAATGCATTGTAGCTCTGAGCCAGGTCTGAGGAATTGTTGCCCAATTCAACAGTGCCAGCATTCCAACTTTGTTAAACCTACCAACATCTTAAATGGACTTTCTGTGGTGGTACCCTTTAAGAGGCGGATGAAAGCTACTACATCAGTTTGCACATTCTAATCACTTTCCAGTATCACAAGAGAGATTTTTACTTACATAATAGTCCTAGAGTATGCAGCTGGTAAAACCAGAGGCTACAATCCAGTATTACTGCTAAGAGACATTTTTCATCCACCAATGTTGTACATGTATGAAAATGGTGTACTGTATACTTTAACACGTCCCATACTTTGTATTGGAGAGTACAATAATGTAAATCCTAAAAGCACCACTATTTTAGCATAATAAAAGAAAGTCCAAAGAGCTCCTATATAGACTACTCCAGATAACTTTGCTTCTTTGATACTTGTAGCTTATTGTAATTTTTTTTAAGAAATTCAAGGTCATTATCATTGTATTGTACAAATAAGCGCTTTGATTAACACAGCTATATAGTTTTTTTAATTTTTAAAAAACCTGTGGAGACAGTGATCTTGTCTTTAAAATATGATAGTCCTTTCAGTATAATGTCTTAGGTTAAAGACGTTGCCTTTAATATCTGTTGGGAAGGAAATGTCCAGACTTTTCAAATCTCTTATTATATGTTTCCTTTTTGTTTACATAGGGAACAATGTTTATAGTTGTGTGTACAGTGGGGGTCTACAACAAGAAGTGTATATTTTCAAACAATTTTTTAATGATTTAACAATTTTTGTAAATCATTTTCAGGCTTCTGCAGCTGTAGATTCTCACTGTGAATCCCTTGCTTGCTCATGCATAAGTGTATTTGCAATACCAAATATACAGGTTTAGTATTTTTGCCTGTTAGTGATTGTTTCACATGTGTAACGTTTTGGTTGAGATGTTAAATGGTGGACGAGTACTGTGGATGTGAATGTGGGAAGTAATTTTAATCATGTGTAATTGGTCACAAGGCCTAATTTGCAGTAACTATTGCTGTTTTATTTAACAATGCCTTGTTGCTTTGTATGCATTAACGTTTGGGTGTAAAGATTGTGTGTCTATCCAACAGGGAGCCACAGTATTTAAATTGACCAACCTAATGTTACAACTACTTTGAGGTGGCCAAATGTAAACTAAAAGCCTTAATTAAAGTGGTGCAATTTTGTATGACTTAGCATCAGTAGTTCAATAAATTTGGATTGCCATGCAAGGGCTTGCATTATAATTACTTGCCACTTGAATGTGTTTTCTGTAATGTTTAACAGTGCTAGTAAATAAATATAGGCTTAACTTTTTCAGTGTACTAGGTGCATTTTACATAGTGTGGTTTCATAATTTAACATTTGGGCAAGCCAAACTTATTAAGTACAGAAATGATGAGTGAAAGATGTCATGTTTTTATCCTAGTATTGTTTGAATATCCACATAATCACCTTTTGAGTTTTTCCTTGGCAAAGAATTTTGTAAATCAAGCAAATTACTTAAGAATATATGCCTTCTGGGTAATGTTCAGTAGCTCTGAGCATAGGAGGAGAATTAAAATACTTTGACAGATATTATGCTTATGAATTTTTAAAAGATACAGGATAAAGTTCGAATATTATGGTTACAAGCCTTTTTGAATGAGGTTGACTCAAAGTACTACTTTCTTTTTAGATAACAGATCTGCCTTTGTCTATGTGTTCTGTAATTCAGTTCTTTTTTGAAACTTGTAAACAAATCTTGACTCAAACTTTGTAAGTATTTGCCAGCCACTGGAGCATAGCAATTAATTCGTGGTAACATCTAGCTTAGGGGGCCTACTAATCCCCTAAATACATGCTATTTGAATGGGATACTTAAAGTCTTTCATTTCAAAAAGAAAAAGGTCTCCTTCCTTATGTATTTC