Transcript asmbl_62935

Sequence
Transcript Sequence for observation asmbl_62935 of TGE0031172:
GTGAGTGGATAGGTGGCCCTGAAAAGGGCCTTTGGTTTTGTAGTAGAAAGCGAGCCGGGGTTCAGACTCAGCCCCCGAAGCCGTAGAGCGTGCGGCCCTGGCGCTTGAGCGCGTAGACCACGTCCATGGCCGTGACCGTCTTGCGCTTGGCGTGCTCCGTGTAGGTGACGGCGTCCCGGATCACGTTCTCCAGGAAGACCTTGAGCACCCCGCGGGTCTCCTCGTAGATGAGCCCGGAGATGCGCTTGACGCCGCCGCGCCGCGCCAGGCGCCGGATGGCGGGCTTGGTGATGCCCTGGATGTTGTCGCGCAGCACCTTGCGGTGGCGCTTGGCGCCCCCCTTGCCGAGCCCCTTCCCGCCTTTGCCGCGACCAGACATTGCGACTTATCAGCTGCTAAGCCTGTGACACAGTGACTATCACTAGCCCAGCTCACCATTTTTATAGTATCCTTACG