Transcript asmbl_62851

Sequence
Transcript Sequence for observation asmbl_62851 of TGE0007108:
GCCGCCTCTCCAGTTATCGGCTCCTCCGAGGAAGGGGGCGGTTGGAGTGGTCTCCATTGTTCGCGGCTTAGGGCGCCATGAGGGGTGACCGAGGCCGAGGTCGCGGAGGGCGCTTTGGTTCCAGAGGAGGCCCAGGAGGAGGGTTCAGGCCCTTTGTGCCGCACATCCCGTTTGATTTCTATTTGTGCGAGATGGCCTTCCCCCGGGTCAAGCCAGCGCCTGATGAAACTTCCTTCAGTGAGGCCTTGCTGAAGAGGAATCAGGACCTTGCTCCTAATTCTGCTGAACAAGCCTCTATCCTTTCTCTGGTGACAAAAATAAACAACGTGATTGACAATTTGATTGTGGCTCCAGGGACATTTGAAGTGCAAATTGAAGAAGTTCGACAGGTGGGATCTTATAAAAAGGGAACGATGACCACGGGGCACAACGTGGCCGACCTGGTGGTAATCCTAAAGATTCTGCCAACGTTGGAAGCTGTCGCTGCCCTAGGGAACAAAGTCGTGGAGAGCCTCAGAGCGCAGGACCCTTCTGAAGTTTTGACCATGCTGACCAACGAAACTGGCTTCGAGATCAGCTCGTCTGACGCGACGGTGAAGATCCTCATCACGACAGTGCCGCCCAACCTCCGGAAACTGGACCCAGAACTCCACTTGGACATCAAGGTGTTGCAGAGTGCCCTAGCAGCCATCCGGCACGCCCGCTGGTTTGAGGAAAATGCCTCTCAGTCCACAGTTAAAGTTCTCATCAGACTGCTGAAGGACCTGAGGATTCGTTTTCCTGGCTTTGAGCCCCTCACACCCTGGATCCTCGACCTACTCGGGCACTATGCCGTGATGAACAACCCCACCAGACAGCCTTTGGCCCTAAACGTGGCATACAGGCGCTGCTTGCAGATCCTGGCCGCAGGACTGTTCCTGCCAGGGTCGATGGGCATCACGGACCCCTGTGAGAGTGGCAACTTCAGAGTACACACAGTCATGACTCTGGAACAGCAGGACATGGTCTGCTACACGGCTCAGACGCTGGTCCGGATACTCTCGCATGGTGGCTTCAGGAAGATCCTTGGCCAGGAGGGTGATGCCAGCTATCTTGCTTCTGAAATATCTACCTGGGATGGAGTGATAGTGACACCTTCAGAAAAGGCTTATGAGAAGCCACCAGAGAAGAAGGAAGGAGAAGAAGAGGAGGAGAATGCAGAAGAACCACCTCCGGGAGAGGAGGAGGAAAGCATGGAGACGCAGGAGTGACCTTGCCTTCACCCTCTTTCTTACCCAAGGGGAAGGAAGACCGGAGCCTAGGCTAACTGCCACTGGGCTTTATATGGTGGCATTTCTGAGGGATGGGGAGACGGGGGAAAAAAAACTCTATGGAAGGAAGTGTCGTCCCACAGACTTCTGCCGTTGGCCTAGTAGCCAGAAGTCCCCCAGTGAAGCAGGATACCAACTTTTCTTCCTTAATACTGTAAACTCCCCAGCTTCCAGAAACCTCTCAACCAGTACTTTGTTGTTGAAATGTGAACTGTTGATGTCTGGAAATTTTTTTCTAGGAAAAATGATTAAAGTACTTCCTAGTAGGGCTCTTGATCTTGTTTTTCCTTGACAATCTAGCAACCTTTGTTTTGGCTTTTTATACTCCTCATTGAAA