Transcript asmbl_62636

Sequence
Transcript Sequence for observation asmbl_62636 of TGE0007072:
CCGGCTTCCAGGAACAGGTGAGAGGGTTTGTGACCGGCTCTCGGAGACTGCGGGTGGGGATGTGGCCTTACCTCTGTAGCACAGGGGGCCCGGCCTGTTGCGTCGGAGTCCCCCCCCGTGTTTGGGGTCGATGGGCCCGACTGGCTGACCCTCTGGATACGCGGAAACTCCCGAGCTCTGTCGTGAGCTTTCTAGGCACCCCTAATATGCCCGATCCCGGGTTGCTCCTCTACGACGCGCCCTCCTTCCTCGCCCGGCGTTGCTCCGGGGCTGTCTCCGCTGTCCCGGCGACCACTGTGGGGCTCGGGGCGCCCAGTCTCAGCCCCAGGCTACATGCCGTAGCACGCAGGGGTTCCGGCTCCATTTCTTCTCTTCTTGGGGGCGAGCCCGCACCCCTTTCACCGCCTACCAGGGAAGACCTGGGTTCTAGACCTGTCGCTGCCACTGCCGTCGTATCTCCTTACCTTCTAGAACCTCACTTTGACCAATAAAATAGGGTTACTTAAGGGTCCTCTCAGGCCCTAGTCCTGAGGTACTTTGCTCTTTCTCCAAGACTTGGAGGAAGAAGCCGAGAGTAGCAATTCCAGAGGCTCCCTGGAGGAGGAGTTGGCGGGCGAGGAGGATAACATGAGGTGGCATTAAGTTCTAGCCATCTGTTTTAAGTGTGATCAGTGGAGTCTCAGCCACCCAGCCATCCTTTTGGTTCACTGCATTTCCTTCTTTCTGTAAATGCTCTGAAGCTCAGTCCAGAAGAGGGCGGGGCCAGGGTCCAGAAGTAAAGGGCTAGGGGTGTGTGTATGGGGGTGACCTGGGGAGCTGCCACCGTGTATCTGCCTTTGGTGCTTGCCCCTGCAGGGAGTGCTGGGTGCTTCCTCCCTATGCCACCCCCACATGATGCCCCTGTCCCGCTGGCTGAGGTCTGTGGGGGTCTTCTTGCTGCCAGCCCCCTGCTGGGTACCCCGGGAGAGGTGGCTGGGTACCCTGCGGCGGCCCTCCCTGGTGTATGGGGGCTCAGTCCTGGGGGCCTGGCACAGTGCCGGCTGCTGGTGCCAAGCGTGGACAGAGGAGCCTCGGGCACATTACTCCTCCCTCAGAATGAATGGAGATCAGAAATCGGATGCTTTCATGCAAGAAAAGCAGAATTTCCTCCAGTGTTTCCCAGTGATCATCAAGGTGCTGACCGATGACTTGGAACACCCAGAGATAAAGGAAGTTCTTGCCCGGCTCAAGCAGGTCCTGGAGTACAATGTCATCGGTGGCAAGCATCAGCGGGGTCTGCTGGTGCTGATCGCGTTCCGGGCGCTGGTCGAGCCGAGAAAGCAGGACGCCGCGAGTGTGCATCGGGCCCTGGTGGTGGGCTGGTGCGTGGAGATGCTCCAGACCTTCTTTCTGGTGCTAGACGACATCATGGACTCATCCATCACCCGACGGGGGCAGCTCTGCTGGTATCGGAAGCCAGGCGTTGGCTTGGATGCCATCAACGACGGTCTTCTCATCGAAACGTGTATCTACCGCCTGCTAAAGCACTACTGCCGGGAGCAGCCCTATTACCTGAACCTGATGGAGCTCTTCCTGCAGAGTTCCTACGTGACAGAGATTGGACAGAGCCTGGACCTCATCGCAGGCCTCCAGGACAAGGTGGATCTCTCAGGATTCACTGAAAAGAGGTACAAGACTATCGTCAAGTACAAGACAGCTTTCTACACTGCCTACCTTCCCGTGGCTGCAGGCATGTACATGGCGGGCATCGATGGGGAGAGGGAGCATGCCACCGCCAAGAAGATCCTGTTCGAGATAGGGGAGTTCTTCCAGATCCAGGACGATTACCTTGATGCCTTTGGGGACCCCAGTGTGACAGGCAAGATTGGCACTGACATCCAGGACAACAAATGCAGCTGGCTGGTGGTTCAGTGTCTGCAGAGGGCCTCCCCGGAGCAGCGCCAGGTCCTGCAGGAGAACTATGGGCAGAAGGAAGCCGAGAAGGTGGCCCGGGTGAAGGCGCTCTACGAGGAGCTGGACCTGCCGGGCGTGTTCTCGCGGTACGAGGAGGACAGCTACCGCCGCATCACGGGGCTCATCGGGGACCTCGCCCCGCCCCTGCCCCCTTCCATCTTCCTGGAGCTGGCACACCACTTCTACAAGCGCAAGAAATGAACTGGAGTGTGGCGCGGGGGGGCCCAATAAACGACACAAGTCCTCGCCTCTGGCTGATGGTTCTTGGGGAGTGCGACGTGTAGCGAAGCCAGTGTCGCCACAGGCTGACTGATATAAACAACAGCTATGCTCTTACGGCACATTTCTGCTCACAGAAAACCATCAAAGTTCTAATTAAGACCCAAACACTTCTCATAGTAAACAGTGAAGTCACTGTGAGCTGTACATACA