Transcript asmbl_62635

Sequence
Transcript Sequence for observation asmbl_62635 of TGE0007072:
GTTGTCGCGGCCCTCCCGCCGCATGCCGGGAATTGTAGTCTAATGAGGCCTTCCTGCCTCGGACGAAAGGAGATCAAGAACTACTCGACCCAGGTGGCTGAGCGCGGAGCGGTGCCACTTTTAGGAATACTCCACGAAAAACCTGCAGGGTGAGCCGGCTTCCAGGAACAGGGAGTGCTGGGTGCTTCCTCCCTATGCCACCCCCACATGATGCCCCTGTCCCGCTGGCTGAGGTCTGTGGGGGTCTTCTTGCTGCCAGCCCCCTGCTGGGTACCCCGGGAGAGGTGGCTGGGTACCCTGCGGCGGCCCTCCCTGGTGTATGGGGGCTCAGTCCTGGGGGCCTGGCACAGTGCCGGCTGCTGGTGCCAAGCGTGGACAGAGGAGCCTCGGGCACATTACTCCTCCCTCAGAATGAATGGAGATCAGAAATCGGATGCTTTCATGCAAGAAAAGCAGAATTTCCTCCAGTGTTTCCCAGTGATCATCAAGGTGCTGACCGATGACTTGGAACACCCAGAGATAAAGGAAGTTCTTGCCCGGCTCAAGCAGGTCCTGGAGTACAATGTCATCGGTGGCAAGCATCAGCGGGGTCTGCTGGTGCTGATCGCGTTCCGGGCGCTGGTCGAGCCGAGAAAGCAGGACGCCGCGAGTGTGCATCGGGCCCTGGTGGTGGGCTGGTGCGTGGAGATGCTCCAGACCTTCTTTCTGGTGCTAGACGACATCATGGACTCATCCATCACCCGACGGGGGCAGCTCTGCTGGTATCGGAAGCCAGGCGTTGGCTTGGATGCCATCAACGACGGTCTTCTCATCGAAACGTGTATCTACCGCCTGCTAAAGCACTACTGCCGGGAGCAGCCCTATTACCTGAACCTGATGGAGCTCTTCCTGCAGAGTTCCTACGTGACAGAGATTGGACAGAGCCTGGACCTCATCGCAGGCCTCCAGGACAAGGTGGATCTCTCAGGATTCACTGAAAAGAGGTACAAGACTATCGTCAAGTACAAGACAGCTTTCTACACTGCCTACCTTCCCGTGGCTGCAGGCATGTACATGGCGGGCATCGATGGGGAGAGGGAGCATGCCACCGCCAAGAAGATCCTGTTCGAGATAGGGGAGTTCTTCCAGATCCAGGACGATTACCTTGATGCCTTTGGGGACCCCAGTGTGACAGGCAAGATTGGCACTGACATCCAGGACAACAAATGCAGCTGGCTGGTGGTTCAGTGTCTGCAGAGGGCCTCCCCGGAGCAGCGCCAGGTCCTGCAGGAGAACTATGGGCAGAAGGAAGCCGAGAAGGTGGCCCGGGTGAAGGCGCTCTACGAGGAGCTGGACCTGCCGGGCGTGTTCTCGCGGTACGAGGAGGACAGCTACCGCCGCATCACGGGGCTCATCGGGGACCTCGCCCCGCCCCTGCCCCCTTCCATCTTCCTGGAGCTGGCACACCACTTCTACAAGCGCAAGAAATGAACTGGAGTGTGGCGCGGGGGGGCCCAATAAACGACACAAGTCCTCGCCTCTGGCTGATGGTTCTTGGGGAGTGCGACGTGTAGCGAAGCCAGTGTCGCCACAGGCTGACTGATATAAACAACAGCTATGCTCTTACGGCACATTTCTGCTCACAGAAAACCATCAAAGTTCTAATTAAGACCCAAACACTTCTCATAGTAAACAGTGAAGTCACTGTGAGCTGTACATACA