Transcript asmbl_62609

Sequence
Transcript Sequence for observation asmbl_62609 of TGE0007064:
CCCTCCTTCCATTCCCAGGACCTATTAGAGCGATTGCCCAGACGCCGGTGACTCAGTGTTCGCGGGAGCGCCGCAGCCACACCAGCCAACCCGGATCCTAGGTCTGACAGCGCCGGCCCGGGTCCCCGCCTGCCAGGAGTAAGCCGACAGGCGGCCGGCCCCGCGTGTCCGACCCAGAGCCACCTCTGTCCTTCGACCCGAGCTCCGCGCCCTTCCTGCGATCCCTGCCCCGCGGGCAGCGCTGCCATCCTGCCGGCCATGGAGACTCCGTCCCAGCGGCGCGCCACCCGCAGCGGGGCGCAGACCAGCTCCACCCCGCTGTCGCCGACCCGCATCACCCGGCTGCAGGAGAAGGAGGACCTGCAGGAGCTCAACGACCGCTTGGCGGTCTACATCGACCGTGTGCGCTCTCTGGAGACGGAGAACGCGGGTCTGCGCCTTCGCATCACCGAGTCCGAGGAGGTGGTCAGCCGCGAGGTGTCCGGCATCAAGGCCGCCTACGAGGCCGAGCTCAGCGATGCCCGCAAGACCCTCGACTCGGTGGCCAAGGAGCGCGCCCGCCTGCAGCTGGAGCTGAGCAAAGTGCGCGAGGAGTTTAAGGAGCTCAAAGCGCGCAATACCAAGAAGGAGGGTGACCTGATGGCCGCCCAGGCCCGGCTCAAGGACCTGGAGGCTCTGCTCAACTCTAAGGAGGCCGCACTGAGCACGGCCCTCAGCGAGAAGCGCACGCTGGAGGGCGAGCTGCATGACCTGCGGGGCCAAGTGGCCAAGCTCGAGGCAGCCCTGGGGGAGGCCAAGAAGCAGCTTCAGGACGAAATGCTGCGGCGGGTCGATGCCGAGAACAGGCTGCAGACCCTGAAGGAGGAGCTAGACTTCCAGAAGAACATCTACAGCGAGGAGCTGCGTGAGACCAAGCGCCGCCACGAGACCCGGCTGGTGGAGATTGACAACGGCAAGCAGCGGGAGTTTGAGAGCCGGCTGGCCGACGCCCTGCAGGAGCTGCGGGCCCAGCACGAGGACCAGGTGGATCAGTACAAGAAGGAGCTGGAGAAGACCTACTCTGCCAAGCTGGACAACGCCAGGCAGTCGGCCGAGAGGAACAGCAACCTGGTGGGGGCCGCCCACGAGGAGCTGCAGCAGTCCCGCATCCGCATAGACAGCCTGTCCGCCCAGCTCAGCCAGCTGCAGAAGCAGCTGGCAGCCAAGGAGGCGAAGCTGCGGGACCTGGAGGACTCGCTGGCCCGCGAGCGTGACACCAGCCGGCGGCTGCTGGCGGAGAAGGAGCGGGAGATGGCGGAGATGCGGGCGCGGATGCAGCAGCAGCTGGACGAGTACCAGGAGCTGCTGGACATCAAGCTGGCGCTGGACATGGAGATCCACGCCTACCGCAAGCTGCTGGAGGGCGAGGAGGAGAGGCTCCGCCTGTCCCCCAGCCCCACCTCGCAGCGCAGCCGAGGCCGTGCCTCCTCCCACTCGTCCCAGACGCAGAGTGGGGGCAGCGCCACCAAGAAGCGGAAGCTGGAGGCCGCCGAGAGCCGTAGCAGCTTCTCCCAGCACGCGCGCACCAGCGGGCGCGTGGCGGTGGAGGAGGTGGACGAGGACGGCAAGTTCGTGCGGCTGCGCAACAAATCCAGCGAGGACCAGACCATGGGCAACTGGCAGATCAAGCGCCAGAACGGAGATGACCCCTTGCTGACCTACCGCTTCCCACCGAAGTTCACCCTGAAGGCCGGGCAGGTGGTGACGATCTGGGCTGCAGGAGCTGGGGCCACCCACAGCCCCCCGACCGACCTGGTGTGGAAGGCACAGAACACCTGGGGCTGTGGCAACAGCCTGCGCACGGCCCTCATCAACTCCACCGGGGAGGAGGTGGCCATGCGCAAGCTGGTGCGCTCGGTGACTGTGGTCGAGGATGACGAAGACGAGGATGGAGATGACATGATCCATCACCACCACGTGAGTGGCAGCCGCCGCTGAGGCCACGCCCACACCCACACCCACACCGGGCGCCAGCCAGGCCCGGCCGCCTCGCCCAGCCTCCCCACACAAAATCTTGTCATTAAAGAGTGTTTTGGAACTTGACTTGCTGCCCTGGCTCTTCTTCTCTCTCCTCCCCATACCTTGAACAGGGACCCCAGGTGTCTGGGCGCCCTACTCTGGTAAGGAAGGGAGTGGGAACTCTCGGTGCCATGGAGTACTCCCGTGGGAGCAGTGGGCCGGGGTCTGGACNNNNNNNNN