Transcript asmbl_27583

Sequence
Transcript Sequence for observation asmbl_27583 of TGE0004596:
CTAGAAAAGCGGCAGCAGCGGCTCTAGCGGCAGTAGCAGCAGCGCCGGCTTGCTGTGCGGAGGTTCTCCTAGCGGTGTTGTTTCTCCAGCGGCGGCAGTTCTCACTACAGCGCCAGGACGAGTCCGGTTCGTGTTCGACCGCGGAGATCTCTCTCATCTCGCTCGGCTGCGGGAAATCGGGCTGAAGCGACTGAGTCCGCGATGGAGAAAACTTTAGAAACTGTTCCTTTGGAGAGGAAAAAGAGAGAAAAGGAACAGTTTCGTAAACTCTTTATTGGTGGCTTGAGCTTTGAAACCACAGAAGAAAGTTTGAGGAACTACTACGAGCAATGGGGGAAACTTACAGACTGTGTGGTAATGAGAGATCCTGCAAGCAAAAGATCGAGAGGATTTGGTTTTGTAACTTTTTCATCCATGGCTGAGGTCGATGCTGCCATGGCTGCAAGACCTCATTCGATTGATGGGAGAGTGGTTGAGCCAAAACGTGCTGTTGCAAGAGAGGAATCTGGAAAGCCAGGGGCTCATGTAACTGTGAAGAAGCTGTTTGTTGGTGGGATTAAAGAAGATACTGAGGAACATCATTTTAAAGATTACTTTGAGGAATATGGAAAAATTGATACCATTGAGATTATTACTGATAGGCAGTCTGGAAAGAAAAGAGGCTTTGGATTTGTTACTTTTGATGACCATGATCCTGTGGATAAGATTGTGTTGCAGAAATACCATACCATCAATGGTCACAATGCAGAAGTAAGAAAGGCTTTGTCTAGACAAGAGATGCAGGAAGTTCAAAGTTCTAGAAGTGGAAGAGGAGGCAACTTCGGTTTTGGAGATTCTCGTGGTGGCGGTGGAAATTTTGGACCAGGACCAGGAAGTAACTTTAGAGGAGGATCTGATGGCTATGGAAGTGGTCGTGGATTTGGGGATGGCTATAATGGGTATGGAGGAGGACCTGGAGGTGGCAATTTTGGAGGTAGCCCTGGTTATGGAGGAGGAAGAGGAGGATATGGTGGTGGAGGACCTGGATATGGCAACCAGGGTGGGGGCTACGGAGGTGGTTATGACAACTATGGAGGAGGAAATTATGGAAGTGGAAATTATAATGATTTTGGAAATTACAACCAGCAACCTTCTAACTATGGGCCAATGAAGAGTGGAAATTTTGGTGGTAGCAGGAACATGGGAGGACCATATGGTGGAGGAAACTATGGTCCTGGAGGAAGTGGAGGAAGTGGGGGTTATGGAGGGAGAAGCCGATATTAAGCTTCTTCCTATTTGCCATGGGCTTCACTGTATAAATAGGAGAGGATGAGAGCCCAGAGGTAACAGAACAGCTTCAGGTTATCGAAATAACAATGTTAAGGAAACTCTTATCTCAGTCATGCATAAGTATGCAGTGATATGGCAGAAGACACCAGAGCAGATGCAGAGAGCCATTTTGTGAATGGATTGGATTATTTAATAACATTACCTTACTGTGGAGGAAGGATTGTAAAAAATGCCTTTGAGACAGTTTCTTAGCTTTTTAATTGTTGTTTCTTTCTAGTGGTCTTTGTAAGAGTGTAGAAGCATTCCTTCTTTGATAATGTTAAATTTGTAAGTTTCAGGTGACATGTGAAACCTTTTTTAAGATTTTTCTCAAAGTTTTGAAAAGCTATTAGCCAGGATCATGGTGTAATAAGACATAACGTTTTCCTTTAAAAATTTAAGTGCGTGTGTAGAGTTAAGAAGCTGTTGTACATTTATGATTTAATAAAATAATTCTAAAGGAAATTGTGTAATTATAGACTTTTTATTTTAAATAAGTTAAGGAGTGGGTAGTATAATTAAGGTCCATTGCAAAGCTGTTATATTTGTGTAAGATAAATGCTGGTCAGATGTAAGTGTGTTGTCTGCAATTCATCAGGATTAAATTATCTAGATAACTTAAGGGATATCTCTGCAAGGAGAAACACCTTTTTAGATCTTTTAGATGCTGCTTCTTCAATGCAAGGAAAGGAAATAACCCCAGCGAGGTACTCTTCAGGGATACAGGTCTAGTACAAGAAAACTTGACGGCTACTAAGTTCAGCCAGTCTTAAAAAACTGTGCTGTTTCTACAAAGCTTTAACTACAGTAGTTTATAAGGATGCCAACGAAAGCTGAGGGTGTAGAGCAAAATAGTTCTAAGCTTCAGTTAAACTTCTTTAGGTAAGATCTCATTTACTTTTTCTTTCTTAATTTTCCTCCCCAAAAGATAAAACTAATACTCTTCAATGGTCTTCCAGTATAGTGGTTCTTATGTAGTTTAACATAGCTGTAAAATTGAGTTTAACAATTTATAAACTCAAGAGAATAATTTTATACACCCTTGTTTTCCAATCTGTCATTTAAATTATTTTGGTTGTTTTTTCCCTTTTTCCTTCTTTCCCACCCCCTCCCCCTCTATGAAGATTCAGGTGCTTAACATATCATTTTTTTCCCTGCTGGAATTTTA