Transcript asmbl_27579

Sequence
Transcript Sequence for observation asmbl_27579 of TGE0004593:
AGGTAATTCGGAGCTCTCAAAATGTTTGCCAAAGCAACAAAGAATTTTCTTAGAGAAGTTGATTCTGGAGGTGATCTGATTGCAGTATCGAACTTGAATGACTCTGATAAGTTACAACTTCTAAGCCTAGTGACCAAAAAAAAGAGATTCTGGTGCTGGCAGAGACCAAAGTATAACTTTTTATCTGTCACCCTTGGAGATGTGCTCATAGAAGACCAATTTCTGAGTCCAGTGGTCGTGGAGTCGGACTTTGTGAAATACGAGGGAAAGTTTAAAAACCACGTGAGTGGAACCATCGAGACGACACTGGGGAAGGTCAAGTTGAATATTGGAGGCAAAGGCCTTATGGAGAGTCAGTCTTCATTTGGAACCCTGAGGAAACAGGAAGTGGACTTGCAGCAGCTCCTCAGGGATGCCGTGGAGAGAACGATAAATCTGAAAAACCCTGTGCTGCAGCAGGTGCTGGAGAGGAAGAATGAGGTCCTGTGTGTCCTGATACAGAAGATAGCGACAACGCAGAAGTGCGTGATCTCTGAGCGCATCCAGGTTGAGGAGAAGTGCGGTGGCATCGTGGGGATCCAAACCAAGACGGTGCAGGTGCAGGCCTCCCGGGGCGGAGGTGCAGGCCTCTCGGGGCCAGAGGTGTCTGCTGCGGAGGATAGGGCTGTCACCAAGGACACCAACGTGGTGTTGGAGATCCCAGCTTCCACCACCATTGCCTACAGTGTCATCGAGTTGTATGTGAAAGTGAATGGCCAGTTCGAATTCTGCCTCCTACAAGGAAAGCATGGTGGCTTTGAGCAAGAGAGAAGAAGCAACTCTGTCTCCCCGAGCTCCCTGCCCTTTCAAGAGTTTGCGTTTAGCGACATGCCAGATGCCTGGCAGGGGCCGCCTGCCTCGGATAAGCCACTGAGTGTTTTAAAAGAAGTGACTCTGCCCTTGGAGAAGAGTTTCCGTCCCTTCGCAGAGCTGCCCGAGCAGCAGCAGACGGCCTTGAGCGGCATCCTGCAGGCGGTCCTGTTTGATGACGAGTTACTCCTGGCCTTGGAGCAAGTGTGTGACGATGTGTTCAGCGATCTGTCACCCCCACGGGTGATACCTGGAGAGCTGAAGCCCTCACAGCAGCAGGACCTCATGGCCTTCCTGCACCTGGTGGGGTACAGCATGCAGAGTGGGTGTCCGGGCCCGGAGGATGCTGTCAGCAACCAGAAGCTCTTCTCTACGGCCTACTTCTTGGTCAGTGCACTAGCAGAAATGCCAGATAATGCAGCAGCTCTTCTGGGCACGTGCTGTAAACTCCAGATTATTCCTACGCTGTGTCACCTGCTCCACGTGCTGTCTGCTGATGGAGAATCTGATCTTGAAGACGCAGCCCTGGCTCCTCTGAGAGATACAGAGAGGTTTGAGATTGTGCAGCGCCTGCTTGCTGCAGCTGACATTAACCTGGAGCGACAGCAGTCGTCCGTGAAAGCTGTCACCTGCCAAGTTCCTAACGTTTCCCCGCTCGTTCTTTATATAAGCCTGAATGGACTCTGGGCTTTAGGCAGAATGCATCAGTAACGTCACACGTGAATCATGAGGACATGTTCTCGGCCAAGGCTGGGTAACTTTCAGGATCGTTGAGATACTACTTTGGGGCCTAGGTCAGATCTATGTTGAAAGATGCTCAAGGAAATGAATTTACAAGAGTCTATGGAGTGGTAACTTTTTACGCTAGGAATCGCCTTGAGTTTAGCCACCAGGTACTCTGTTTCTGTTTCATACGAGGCCCTCCTGTGCTGGTCACCCCATGTGCAAGTTCAACTCCAGCACCCGAAGGCCTGGGGAAGGGATGAGAATTCTAAGCCAGAG