Transcript asmbl_61205

Sequence
Transcript Sequence for observation asmbl_61205 of TGE0006993:
ATTTATTTCAGATTTAACTGAGCACACACACATTTCCAAATGGTTCTATGTTTGGCTCAACTGTTACCTCTTGAGAGTCAATTTCTGCAGCTTCAACTAATGGTATCATTTTTTACTGACTTTTGGCACTTACTTTTTTAAGTTGATTTTTTTCTCTCCCCCTCTCTCTGACTTTGAGTGTAAGAGGGTCTGTGTCTACAAAGGAAACTTTAATATATGTCCTTATTGACCTGTCCCTAATCACAGGACGATACTTTGATGAAATCAGCCAGGACACGGGCAAGTACTGTTTTGGAGTTGAAGATACACTAAAGGCTTTAGAAATGGGAGCTGTAGAGATTCTAATAGTCTATGAAAATCTGGATATAATGAGATATGTTCTTCATTGCCAAGGCACAGAAGAGGAGAAAATTCTCTATCTAACTCCAGAACAAGAGAAGGATAAATCTCATTTCACAGACAAAGAGACAGGACAAGAACATGAACTAATTGAGAGCATGCCCCTGCTGGAATGGTTTGCTAACAACTATAAAAAATTTGGAGCTACATTGGAAATTGTCACAGATAAGTCACAAGAAGGATCCCAGTTTGTGAAAGGATTTGGTGGAATTGGAGGTATCTTGCGGTACCGAGTAGATTTCCAGGGAATGGAATACCAAGGAGGAGACGATGAATTTTTTGACCTTGATGACTACTAGGTAGTCGACATGGGTCCGGCAAAATGTGCCTCACCCTCCAGCATCCAACCCAAGGAGCATACCCGTGGTGGAATCCAAACAGATCCCTGCCTTACAATTGGAACATTTCCAGAACTTAATCCATGAGCATTGGATATTGAAAAGAAAACCGAAACAAAACCAGACCCAACCCTACACTTTGGTTTGTCATGGTGTCAGCGCAGCAGCCTACAACTAAGTTCCTAAATGCCACTTTGGACTAATTTAAACAAGAATCCCAGTTTTTACTTTTACTCGATGGTGAAATTGGTTGCTCTTGTATTTTATGAAAAAAAAATGATTTTTTTAACCTTCATACATAGAAGCAAAAATACTTTAACTGCTGTAAACCTTCAAAAGTTAATAGAAATGAGATCATACTGGTTTGTTTCTTATTTTGATTGGAGAAAAATTAAATTGCTGCATTTCGCAGTGACCCATTTACATGGCATTCTCAGCTTAGACTGCATAAGAAGAAATATACGTGGTGAAATGTTGGAACCATTTCTCTCTTGGTCTCTTGTTTAATGTTGAAAGGGTGAGCTAATAGGCAATTTCAACTTCACTCCCTCACACTACCCGTGCCCCTACAGACTGTCAGTTTCAAGGATGCAAATTGCATTGCAGCGTCAAACTGACAACATGAAGCATTTGGGCCAGTGCACCGTTTCCTTCCACGTGTTTTGCAGGCGCATTTGTGCCCAGGGTTTGGGAGCCCTTAGCATCAATTGCTTTGACAAGGGTTCTCATAATCTTAGCCTACTAGAAACCAGTTTGGGATGGATATGGGGCTTCTGTGCTATTGCTGGGATTGGGAGAAATAAAACATGCAATATAAATGGAAGCAAAGAAATTTAAAGAATATTTTATTTTGCTTGGGTCTATCCTTGGTCAAAGGGAGGTGGTCGTGTTTTCCTTGTGTTGGATGGCATGAGATTATGTGAATGTTTTGATTTTTTAAAAAAAATGAACTGCAAGGTTTTTCACAGGAACGACAGACAAGACACGTATGACTGTGCATGTAATTATAAGCCCCTGACCTCCTGGTGGGGTTGGAGCATCTGTTTCGAATATGGGACTTGTAAACACCTCTCATAGGAGAAAG