Transcript asmbl_61201

Sequence
Transcript Sequence for observation asmbl_61201 of TGE0002143:
ATGTCACAGGCCCCATGTGAGCGGATTGCAACACATGCAGCTGCCTGGAGAGAGGGAACCGGTGTCCTACGTCAGAGCCGCCGCCGCGGAGCCGCCGCCGGGGAGGAGCAGCCACTGCCGCCCAGGACTGGGCCCTTAGGGAGGAGGAGGCGAGAAGATGGCGGACGACCCCAGTGCTGCCGATAGGAACGTGGAGATCTGGAAGATCAAGAAGCTCATTAAGAGCTTGGAGGCGGCCCGCGGCAATGGCACAAGCATGATATCATTGATCATTCCTCCCAAAGACCAGATTTCACGAGTGGCAAAAATGTTAGCAGATGAGTTTGGAACTGCATCTAACATTAAGTCACGAGTAAACCGCCTTTCAGTCCTGGGAGCCATTACATCTGTACAACAAAGACTCAAACTTTATAACAAAGTACCTCCAAACGGCCTGGTTGTTTACTGTGGTACAATTGTAACGGAAGAAGGAAAGGAAAAGAAAGTCAACATTGACTTTGAACCTTTCAAACCAATTAATACGTCATTGTATTTGTGTGACAACAAATTCCATACAGAGGCTCTTACAGCACTACTTTCGGATGATAGCAAGTTTGGCTTCATTGTAATAGATGGTAGTGGTGCACTTTTTGGCACACTCCAAGGAAACACAAGAGAAGTCCTGCACAAATTCACTGTGGATCTCCCAAAGAAACATGGTAGGGGAGGTCAGTCAGCCTTGCGTTTTGCCCGTTTAAGAATGGAAAAGCGACATAACTATGTTCGGAAAGTAGCTGAGACTGCTGTGCAGCTGTTTATTTCTGGGGACAAAGTGAATGTGGCTGGTCTCGTTTTAGCTGGATCAGCTGACTTTAAAACTGAACTAAGTCAATCTGATATGTTTGATCAGAGGTTGCAATCAAAAGTTTTAAAATTAGTTGATATATCTTATGGTGGTGAAAATGGATTCAACCAGGCTATTGAGTTATCTACTGAAGTCCTCTCCAACGTGAAATTCATTCAAGAGAAGAAATTAATAGGACGATACTTTGATGAAATCAGCCAGGACACGGGCAAGTACTGTTTTGGAGTTGAAGATACACTAAAGGCTTTAGAAATGGGAGCTGTAGAGATTCTAATAGTCTATGAAAATCTGGATATAATGAGATATGTTCTTCATTGCCAAGGCACAGAAGAGGAGAAAATTCTCTATCTAACTCCAGAACAAGAGAAGGATAAATCTCATTTCACAGACAAAGAGACAGGACAAGAACATGAACTAATTGAGAGCATGCCCCTGCTGGAATGGTTTGCTAACAACTATAAAAAATTTGGAGCTACATTGGAAATTGTCACAGATAAGTCACAAGAAGGATCCCAGTTTGTGAAAGGATTTGGTGGAATTGGAGGTATCTTGCGGTACCGAGTAGATTTCCAGGGAATGGAATACCAAGGAGGAGACGATGAATTTTTTGACCTTGATGACTACTAGGTAGTCGACATGGGTCCGGCAAAATGTGCCTCACCCTCCAGCATCCAACCCAAGGAGCATACCCGTGGTGGAATCCAAACAGATCCCTGCCTTACAATTGGAACATTTCCAGAACTTAATCCATGAGCATTGGATATTGAAAAGAAAACCGAAACAAAACCAGACCCAACCCTACACTTTGGTTTGTCATGGTGTCAGCGCAGCAGCCTACAACTAAGTTCCTAAATGCCACTTTGGACTAATTTAAACAAGAATCCCAGTTTTTACTTTTACTCGATGGTGAAATTGGTTGCTCTTGTATTTTATGAAAAAAAAATGATTTTTTTAACCTTCATACATAGAAGCAAAAATACTTTAACTGCTGTAAACCTTCAAAAGTTAATAGAAATGAGATCATACTGGTTTGTTTCTTATTTTGATTGGAGAAAAATTAAATTGCTGCATTTCGCAGTGACCCATTTACATGGCATTCTCAGCTTAGACTGCATAAGAAGAAATATACGTGGTGAAATGTTGGAACCATTTCTCTCTTGGTCTCTTGTTTAATGTTGAAAGGGTGAGCTAATAGGCAATTTCAACTTCACTCCCTCACACTACCCGTGCCCCTACAGACTGTCAGTTTCAAGGATGCAAATTGCATTGCAGCGTCAAACTGACAACATGAAGCATTTGGGCCAGTGCACCGTTTCCTTCCACGTGTTTTGCAGGCGCATTTGTGCCCAGGGTTTGGGAGCCCTTAGCATCAATTGCTTTGACAAGGGTTCTCATAATCTTAGCCTACTAGAAACCAGTTTGGGATGGATATGGGGCTTCTGTGCTATTGCTGGGATTGGGAGAAATAAAACATGCAATATAAATGGAAGCAAAGAAATTTAAAGAATATTTTATTTTGCTTGGGTCTATCCTTGGTCAAAGGGAGGTGGTCGTGTTTTCCTTGTGTTGGATGGCATGAGATTATGTGAATGTTTTGATTTTTTAAAAAAAATGAACTGCAAGGTTTTTCACAGGAACGACAGACAAGACACGTATGACTGTGCATGTAATTATAAGCCCCTGACCTCCTGGTGGGGTTGGAGCATCTGTTTCGAATATGGGACTTGTAAACACCTCTCATAGGAGAAAG