Transcript asmbl_61195

Sequence
Transcript Sequence for observation asmbl_61195 of TGE0031093:
CGGGTTCAGACGGGCGCTGCCGCGTCTGCGCATCCGGAGCGGGTTGCCGGTGCGACAGCCTGGAATTGTGGGGGTTGTGTCTGCCCCTTGGCTGTCAGGCGGGAAGCCGAAGGTCTCCCTGTGCCTCCCGAGGGCCTGCCCCTATCTAGGATGGCTCCTCACGGCATGCTGCTCGGGCTGCTGATGGCTTCCTGCTTCATCTTCTGCCTCAGTCATCAGAACCCAGAGTTTGCACTGACCTACCCAGAGAGGAGCAGCACCAAAGAAACAGAGAGAAAGGAAACCACAGCAGAGGAGGAGCTGGACCCCGAGGTTCTGAATGTGTTTCACCCGACCCATGAGTGGCAGGCCCTTCGGCCAGGTCAGGCTGTCCCTGCAGGATCCCATGTGCGGCTGAATCTTCAGACTGGGACAAGAGAAGTGAAACTCCAAGATGAGGACAAGTTCCAAAATACTTTGAAAGGGTCGAAAAAAGGCAAAAGGCTGGACATCAATACCAACACCTACACCTCTCAGGACCTCAAGAGTGCACTGGCAAAATTCAAAGAAGGGACAGAGATGGAGAGTTCAAAGGAGGACAAGGCAAGGCATGCTGAGATTAAACGGCTTTTCCGCCCCATTGAGGAGCTGAAGAAGGACTTTGAAGAGCTGAATGTTGTCATTGAGACTGACATGCAGATCATGGTACGGCTGATCAACAAATTCAATAGTTCCAGCTCCAGCCTGGAGGAGAAGATTGCTGCACTCTTCGATCTTGAATATTATGTCCATCAGATGGATAATGCACAGGATCTGCTTTCCTTCGGTGGCCTTCAAGTGGTGATCAATGGGCTGAACAGCACAGAGCCCCTGCTAAAGGAGTATGCTGCGTTTGTGCTGGGGGCAGCCTTTTCCAGCAACCCAAAGGTCCAGGTGGAGGCCATTGAGGGGGGAGCTCTGCAGAAGCTGCTAGTAATCCTGGCCACGGAGCAGCCTCTTACTGTAAAGAAGAAGGTCCTGTTTGCACTGTGCTCCCTGCTACGACACTTTCCCTATGCCCAGCAACAGTTCCTGAAGCTGGGGGGGCTACAAGTCCTAAGGAGCCTAGTGCAAGAGAAGGGCACGGAGGTGCTGGCCGTGCGTGTGGTCACCCTGCTCTATGATCTGGTCACTGAGAAGATGTTTGCCGAAGAGGAGGCCGAGCTAACCCAGGAGACATCCCCAGCGAAGCTGCAGCAATATCGCCAGGTGCACCTCTTGCCAGGCCTGCGAGAACAGGGCTGGTGCGAGATCACTGCCCACCTCCTGGCACTGCCTGAGCATGATGCCCGTGAAAAGGTGCTGCAGACGCTGGGCGCCCTCCTTGCCACCTGCCGGGACCACTACCATAAGGACCCACAGCTCAGCAGGATGCTGGCCAGCCTGCAGGCTGAATACCAGGCGCTGGCTACCCTGGAGCTTCAAGGTGGCGAGGACGAGGGCTACTTCCGGGAGCTGCTGGGCTCCATC