Transcript asmbl_61141

Sequence
Transcript Sequence for observation asmbl_61141 of TGE0006979:
GGCAGCCACCGCGGGAGCCCAGGAGGGGGGCGGAGGCGAGGGGAGGCGGCGGCCGCGGCCAGCGCACCATTCGCTCCACCTGATCTCGGGGCGCTGTGCGCTGAGGAAGTCGCGGGCGAGCGGGAGCAGAAGGAGGGAGGGACGCCGCCGCTGCAGCCACCGCCGCCACCATGTCCTACCAAGGCAAGAAGAACATCCCGCGGATCACGAGTGACCGTCTTCTTATCAAGGGAGGCAGAATCGTCAACGATGATCAATCTTTTTATGCTGATATTTACATGGAAGATGGCTTAATAAAGCAAATCGGAGACAACCTGATTGTCCCTGGAGGAGTGAAGACCATCGAGGCCAATGGGAAGATGGTGATTCCTGGCGGCATCGATGTCCACACTCACTTCCAGATGCCCTACAAGGGGATGACCACAGTGGATGACTTCTTCCAAGGGACAAAGGCCGCCTTAGCGGGTGGCACAACCATGATCATTGACCATGTGGTGCCCGAGCCGGAGTCCAGCCTGACGGAGGCCTATGAGAAGTGGCGAGAATGGGCCGATGGGAAGAGCTGCTGTGACTACGCCTTGCACGTGGACATCACCCACTGGAATGACAGTGTCAAGCAGGAGGTGCAGAGCCTCATCAAGGACAAAGGGGTTAACTCCTTCATGGTTTACATGGCCTATAAGGATTTGTATCAAGTGTCCAACACAGAGCTCTACGAGATCTTCACCTGTCTGGGAGAGCTGGGAGCCATTGCTCAAGTTCATGCTGAGAATGGGGACATCATCGCCCAGGAGCAAAGCCGGATGTTGGAAATAGGGATAACTGGCCCAGAAGGCCATGTACTGAGCAGACCAGAGGAGCTGGAAGCTGAGGCCGTGTTCCGTGCCATCACCATCGCCAGCCAAACCAACTGCCCTCTCTATGTCACGAAGGTCATGAGCAAGAGTGCAGCTGACCTCATCTCACAAGCCAGGAAAAAAGGAAACGTGGTCTTTGGCGAGCCCATCACTGCCAGCCTCGGCACAGATGGAACCCATTACTGGAGCAAGAACTGGGCCAAAGCAGCTGCCTTTGTGACATCCCCACCTCTGAGTCCTGACCCGACCACTCCTGACTACATCAACTCCTTGCTGGCCAGTGGGGACCTGCAGCTTTCTGGCAGTGCCCACTGCACCTTCAGCACCGCCCAGAAAGCAATCGGGAAGGACAATTTCACAGCCATTCCCGAGGGCACCAACGGGGTAGAGGAGCGGATGTCTGTCATTTGGGACAAGGCTGTGGCCACCGGGAAAATGGATGAAAACCAGTTCGTGGCCGTGACTAGCACGAATGCTGCCAAGATCTTCAACCTGTATCCCCGCAAGGGAAGAATATCTGTGGGTTCTGACAGTGACCTGGTGATCTGGGATCCAGATGCAGTAAAGATTGTGTCCGCCAAGAACCACCAGTCGGCTGCAGAGTACAACATCTTTGAAGGGATGGAGCTGCGTGGAGCCCCTCTGGTGGTCATCTGTCAGGGCAAGATCATGCTGGAAGATGGCGGCCTGCACGTGACCCAGGGGGCTGGCCGCTTCATCCCCTGCAGCCCCTTCTCCGACTATGTCTACAAGCGCATAAAAGCCAGGAGGAAGATGGCAGACCTGCACGCGGTCCCGAGGGGCATGTACGATGGGCCCGTGTTCGACCTGACCACCACGCCCAAGGCGGGCACCCCGGCGGGCTCCACGCGGGGCTCTCCCACGCGGCCGAACCCGCCCGTGAGGAACCTCCACCAGTCCGGATTCAGCCTGTCGGGAACCCAAGTGGACGAAGGGGTCCGCTCCGCCAGCAAGCGCATCGTGGCGCCCCCTGGAGGCCGTTCTAACATCACATCTCTGAGTTAAGCCACCCCTTCCCAAAGAGGGGCAGAAGCAGCAAGAGATTTTTTGAAGCCAAAATGGTACACCGATATTTAAGAAGGAAAGCGAAAACAGTTGCGATCTAAAGAATCAATAAGCCTCAAGCCTTATGTTTCTCCAATGTTACGCTCGCTTGCCTAGCTTTACGAAAATTGCTTTGTTTTCTGTCTGTGCCTAGCCTTGATTTGGTTGACTCCTCCCCCCCATTTGCATGCATGCAATCAGGCCACTAAGGTAAAAGAGTCTGCTATATAGTGTTGAGAGCGTGTGTAGTGCTGCATCTTAAGACAAGGGGACAGACAAAGCTGGATGTCAGGAAAATGAACAAAAGGGACACAGTTATTTGGGGTGAGTGGGTGGTGGGAGCCCAGAGCAAGATGGAGGGTTCAGCGGGGCTGGGGTAGGGTATGTAAGCG