Transcript asmbl_17863

Sequence
Transcript Sequence for observation asmbl_17863 of TGE0000466:
CGGGTTCCCTACGGGACTCTGAAGGCTGAGGATATCCGGCCCGGAGCGTTTGTGCGGCGCGGAGTTAAGCGCCCCGGCAGTAACTTAAGGGAAGTGGACCAGGGTTGCCGCTGCCCAGAGCGGTCCTTTAGTTTCCACTGGAGTGGAGGGAAGAGTGCTGCCATGGCAGCCCCTGCGCAGCCCAAGAAGATCGTGGCCCCTACGGTGTCCCAAATCAATGCGGAGTTCGTGACCCAGTTAGCATGTAAATACTGGGCTCCCCACATCAAGAAGAAATCACCTTTTGATATAAAGGTTATTGAAGATATATATGAAAAAGAGATTGTCAAATCAAGGTTTGCTATTAGAAAGATAATGCTCTTGGAATTTAGCCAGTATCTTGAAAATTATCTCTGGATGAATTATTCTCCTGAGGTATCTAGCAAGGCCTATTTAATGTCAATCTGCTGTATGGTGAATGAGAAGTTTAGAGAAAACGTGCCTGCATGGGAGATTTTTAAGAAGAAGCCAGACCACTTCCCATTCTTTTTTAAACACATCTTGAAGGCGGCATTAGCTGAAACTGATGGTGAATTTTCACTTCATGAACAGACAGTCTTACTACTTTTTCTTGATCATTGCTTCAATAGTTTGGAAGTAGACTTGATACGAAGTCAAGTACAGCAGCTTATCTCCCTCCCAATGTGGATGGGCTTACAGCTGGCACGATTGGAATTAGAATTAAAAAAGACACCTAAGCTAAGAAAATTCTGGAACTTGATTAAAAAGAATGATGAAAAGATGGATCCAGAAGCAAGAGAACAGGCATATCAAGAGAGGAGATTTCTTTCACAACTCATCCAGAAGTTTATCTCTGTGCTGAAATCAGTCCCACTTTCTGAACCTGTCACTATGGACAAAGTTCATTACTGTGAAAGATTCATTGAACTTATGATTGATCTAGAGGCCCTGCTACCCACAAGGCGCTGGTTTAATACCATCCTGGATGATTCCCACCTTCTGGTTCACTGTTACCTTTCCAATCTTGTTCGTAGAGAAGAGGATGGCCATCTTTTTTCCCAGCTTTTGGACATGCTTAAATTCTATACTGGTTTTGAAATTAATGACCAAACTGGAAATGCTCTGACAGAGAATGAGATGACCACAATTCACTATGATAGAATTACTTCTCTACAGAGAGCTGCTTTTGCACATTTTCCTGAACTCTATGATTTTGCCCTCTCAAATGTGGCAGAAGTAGATACTCGGGAGTCCTTGGTCAAGTTTTTTGGACCTCTTAGTTCAAACACACTCCACCAGGTGGCATCATACCTCTGCTTGTTGCCAACTCTTCCTAAAAATGAAGACACAACTTTTGATAAAGAATTTCTTCTAGAATTGCTGGTATCTCGTCATGAACGTCGAATTTCTCAGATTCAGCAGTTGAACCAGATGCCTTTGTATCCAACTGAGAAAATTATATGGGATGAAAATATTGTCCCAACTGAGTACTATTCTGGAGAAGGTTGTCTTGCTCTTCCCAAATTGAATTTGCAGTTTTTGACTCTTCATGACTACCTGCTAAGGAACTTTAACCTCTTCCGCTTAGAATCAACTTATGAAATTCGTCAGGACATTGAAGATAGTGTCAGCAGAATGAAGCCATGGCAATCTGAATATGGCGGTGTAGTGTTTGGTGGTTGGGCGCGAATGGCCCAGCCCATTGTGGCTTTCACTGTCGTTGAAGTGGCCAAACCCAACATAGGTGAAAACTGGCCAACCCGAGTTCGTGCAGATGTTACCATAAATCTCAATGTCAGAGATCACATCAAAGATGAATGGGAAGGTCTTCGTAAGCATGATGTATGCTTTTTAATTACCGTACGTCCCACAAAACCTTATGGCACTAAGTTTGACCGGAGGAGACCTTTTATTGAGCAGGTTGGCCTGGTTTATGTCAGAGGCTGTGAAATTCAGGGCATGCTGGATGATAAAGGACGTGTCATTGAAGATGGACCTGAACCCAGACCCAATCTTAGAGGAGAATCAAGGACATTTAGAGTGTTTTTGGATCCAAACCAGTATCAACAAGATATGACCAATACTATACAAAATGGAGCAGAGGATGTGTATGAAACTTTTAATATAATAATGAGGAGAAAACCAAAGGAAAATAACTTTAAGGCTGTGCTGGAGACTATTCGGAACCTGATGAATACTGATTGTGTGGTACCTGACTGGCTGCACGATATCATTTTAGGTTATGGGGACCCAAGTAGTGCACATTATTCGAAAATGCCCAATCAGATTGCCACCCTTGATTTCAATGATACATTTCTCTCCATTGAGCATTTAAAAGCCAGCTTCCCTGGTCATAATGTTAAAGTAACTGTAGAAGACCCTGCTCTACAAATACCCCCTTTCAGGATAACTTTTCCAGTAAGAAGTGGAAAAGGGAAGAAAAGGAAAGATGCGGATGTGGAAGATGAAGACACCGAGGAAGCAAAAACCTTAATTGTTGAGCCCCATGTTATTCCTAATAGGGGTCCTTATCCTTATAATCAACCCAAACGTAATACGATTCAGTTCACTCATACACAGATAGAAGCCATCCGTGCTGGAATGCAGCCTGGGCTGACTATGGTTGTGGGCCCACCTGGTACAGGCAAAACAGATGTGGCAGTTCAGATCATATCCAACATCTACCACAACTTCCCAGAACAGAGGACTCTAATTGTTACTCATTCCAATCAGGCCCTAAACCAGTTGTTTGAGAAAATCATGGCATTAGACATTGATGAGCGCCACCTACTGCGTCTTGGTCATGGAGAAGAAGAGCTGGAGACAGAGAAAGATTTCAGCAGGTATGGAAGAGTTAATTATGTTCTGGCTCGAAGAATAGAACTTTTAGAAGAAGTCAAACGATTGCAAAAGAGTCTAGGGGTTCCAGGAGATGCCTCATATACCTGTGAAACTGCAGGCTATTTCTTCTTATACCAGGTAATGTCTCGCTGGGAAGAGTATATCAGCAAAGTGAAAAATAAAGGTAGTACATTGCCAGATGTTACGGAAGTCTCCACTTTCTTCCCTTTCCATGAATACTTTGCAAATGCTCCTCAACCCATTTTTAAAGGAAGATCTTATGAAGAAGACATGGAAATTGCTGAAGGATGTTTCAGGCATATTAAGAAAATCTTTACGCAGCTTGAGGAATTCAGAGCCTCTGAATTGCTTCGAAGTGGACTGGACAGATCTAAATACCTTTTAGTGAAAGAAGCCAAAATTATTGCTATGACCTGTACTCATGCTGCCTTAAAACGACATGACTTGGTCAAGCTAGGTTTCAAGTATGACAACATTTTGATGGAAGAGGCTGCTCAGATTCTGGAGATAGAAACTTTTATCCCTCTTCTTCTACAGAATCCTCAGGATGGATTTAGCCGACTAAAACGATGGATTATGATTGGCGATCATCACCAGTTACCTCCAGTTATTAAGAACATGGCCTTTCAAAAGTACTCAAACATGGAGCAGTCTCTCTTCACTCGCTTTGTTCGCGTTGGAGTTCCGACTGTTGACCTTGATGCTCAAGGGAGAGCCAGAGCAAGCTTGTGCAACCTCTACAACTGGCGATACAAGAATCTAGGAAACTTACCCCATGTGCAGCTCTTGCCAGAGTTTAGTACAGCAAATGCTGGCTTACTGTATGACTTCCAGCTCATTAATGTTGAAGATTTTCAAGGAGTGGGAGAATCTGAACCTAATCCTTACTTCTATCAGAATCTTGGAGAGGCAGAATATGTAGTAGCACTTTTTATGTACATGTGTTTACTTGGTTACCCTGCTGACAAAATCAGTATTCTAACAACATATAATGGCCAAAAGCATCTTATTCGCGACATCATCAATAGACGATGTGGAAACAATCCATTGATTGGAAGACCAAACAAGGTGACAACTGTTGATAGATTTCAAGGTCAACAGAATGACTATATTCTTCTTTCTCTGGTACGAACCAGGGCAGTGGGCCATCTGAGGGATGTCCGTCGCTTGGTAGTGGCCATGTCTAGAGCCAGACTTGGACTTTATATCTTCGCCAGAGTATCCCTCTTCCAAAACTGTTTTGAACTGACTCCAGCTTTCAGTCAGCTCACAGCTCGCCCCCTTCATTTGCATATAATTCCAACAGAACCTTTCCCAACTACTAGAAAGAATGGAGAGAGACCATCTCATGAAGTACAAATAATAAAAAATATGCCCCAGATGGCAAACTTTGTATACAACATGTACATGCATTTGATACAGACTACACATCATTATCATCAGACTTTATTACAACTACCACCTGCTATGGTAGAAGAGGGTGAGGAAGTTCAAAATCAAGAAACAGAATTGGAAACAGAAGAAGAGGCCATGACTGTTCAAGCTGACATCATACCCAGTCCAACAGACACCAGCTGCCGTCAAGAAACTCCAGCCTTTCAAACTGACACCACCCCCAGTGAGACAGGAGCCACTTCCACTCCAGAAGCCATCCCTGCTTTATCTGAGACCACCCCTACTGTGGTAGGAGCTGTATCTGCACCGGCAGAAGCTAACACACCTCAGGATGCCACATCTGCCCCGGAAGAGACCAAGTAGCCAAACTGTAGTCCTTCTAAAGGAGGACATGGCAGTCAAAAAGTCTGAGTAAAGCTGTTTTTTGTATTTTATATTTGCTTCTGCCATTTTACTGTCACTAATTAATGTTTAGTTCTTATATTTGTTAACTGATTTCGGTGTCTTGAATATATTTTTTTAAATTATGTGTATGAACAATTCTAGTTTCATTTGTTCAATCAGAAGAGCAAATAACCATTCCTTTCATGTTTTGATCACTGAGTGTGTCTGTAATCATACCTACATTAAAATCATTTTCTATGAATATATAAT