Transcript asmbl_60668

Sequence
Transcript Sequence for observation asmbl_60668 of TGE0006944:
CAGCCATTTGCTGGGTCCTGGAGGGAGGCGGCGGCCGCGTAGTCTTTCCTGCCCCTTGTCCGCCTCTTCTTCCTGCTCGCGGCCCGCCCGCCGGCTCGCACCCAGCCGCAGCGGCGTGGACGGAGGATACGACTGGGACGGCGCCGGGAGCCGAGGTGCTGAGGGACGGTGGCCGACTTAGGAGAGATGCTGGGCGTGGCGGCAGGAATGACCAACAGCAACATGGCCAATGCCCTTGCCAATGCTGCTTGTGAGCGCTGCAGGGGGGGTTTTGCACCCGCCGAGAAGATTGTAAACAGTAATGGCGAGCTGTACCATGAGCAGTGTTTTGTGTGTGCTCAGTGCTTCCAGCAGTTCCCAGAAGGACTCTTCTATGAGTTTGAAGGAAGGAAATACTGTGAACATGATTTTCAGATGCTCTTTGCTCCTTGCTGTCATCAGTGTGGCGAATTCATCATTGGCCGAGTTATCAAAGCCATGAATAACAGCTGGCATCCTGAGTGCTTCCGCTGTGACCTCTGCCAGGAAGTGTTGGCAGATATCGGGTTTGTCAAGAACGCTGGGAGACATCTGTGTCGCCCCTGTCATAATCGTGAGAAAGCCAGGGGCCTTGGAAAATACATCTGCCAGAAATGCCACGCCATCATTGATGAGCAGCCTCTAATATTCAAGAACGACCCTTACCATCCAGACCATTTCAACTGTGCCAACTGCGGGAAGGAGCTGACTGCTGATGCTCGGGAGCTGAAAGGAGAACTGTACTGCTTGCCGTGCCATGATAAAATGGGGGTCCCCATCTGTGGTGCCTGTCGACGGCCCATTGAAGGGCGTGTGGTAAATGCCATGGGCAAGCAGTGGCACGTGGAGCATTTTGTTTGTGCCAAGTGTGAAAAACCATTTCTTGGACATCGCCATTATGAAAGGAAGGGCCTGGCATATTGTGAAACCCACTATAACCAGCTATTCGGTGATGTTTGTTTCCACTGCAACCGTGTTATAGAAGGTGATGTGGTTTCTGCTCTTAATAAGGCCTGGTGCGTGAACTGTTTTGCCTGTTCTACCTGCAACACTAAGTTAACACTCAAGAATAAATTTGTGGAGTTTGACATGAAACCTGTCTGTAAGAAGTGTTATGAGAAATTTCCACTGGAGCTGAAGAAAAGACTTAAGAAACTAGCTGAGACCTTAGGAAGGAAATAATTTCCTTTATTATTTTCTTCTTTGCAAAGATCAGAGATTACCAACATTATTGATGTGATCTACCCTTATTTAAACCTATTTCTCAAAATAGTTGAGAGTGAAGAAAACCTACATGGTTTTCTTCATCTCTTTTTTTCTCATTAAAAAAGAAAATAAATTTGTGTAATCATATTTAAAACAGATAAAATCAAGATTTGCCTTTGTCAGTAATCATCAATTTGTTTAAGTATAGACTATACTTAATAGCAAAAATCACATAGCTAAATGTTAATTAAGGTCCAAAAATTTACATACAACTTTTTAAAAATGAAAGTAATGAGTCAGCTTTTATAAGACACAGCTAAAAAATATAAACTTTATTTTACTTTGTACTCAAAAGAAAATTAAATCCAACTGCTGTTAGGGACATTGTAGAGAAGAAAACTAACCAAGAAAAACAAATCTTATGGAATCTTAGTATGTTAATCAGACTGGTAGCTACAAAATGAATATACACATTACTAAGACAAGAAACAAGTATATTCAGAACTACTTGATTTTAGAGGTTTTTTGTTGTGAAATTCAATAATTATGCTGTTTTATATTTTGTTCTCCTTGTGAACTTCTTCTTTCATACAATTACTTAACATAGTTACGGCTAGCTTATAGTATGTTTTTTTTAATTTTGTGCAAAAAAAATTTATTCTATGTATTTGACAATACAGCATACTTTACAATATTGGAAAATGGAGTATTTTTTAATGTATTACAGCAATTATGTTTCTAAACATAAGGTCAAAGATGTAGTCTTAGAATAGGACATGAAATTAAATTTTATGTAGCTTGGATGTATCATTTAAAAAAAGTGAATGTATACGTATTGGTCATATTACCTTTATTATAACCATATTAATATCTATGCTTTATACATAACCTTGCCTTGTCTTAGAAAAACACATACCTTAATCAGGAATTCAAGCAGCTTCATATAATACCAACTAAAAATAGGTACACTGGTTGAGATTTATAAACTCAAATTTATTTGCCACAGCTACGATTATTTAAAAAAAATTTTTTTCTCCCTTTTTGGGAAACATTAAAATTAATTTCTGCCATCTTAGTATAAGAGAATGATGTTGATATGTTTCAAGTTTTTCACTTCAAATTTCATAATTAATTGAATTTATTTGCTATAAGTAAGAAGTATAAATGATACTTTTAAATTGGAAAAGGGATGTTTAAGTGTCAATTTTAGGTCAAAAAGTCATGAATTATTCTACTTTATCTTATTCTGAAGTTTCTGGACCATTCTTTCTCGATAAACTTGGATGCAAAGCAAACTTTGTGAACATTATTTAAATGTTGCTGTGTTATTTAAAAGAAAGTTGCCAAGATGGACTTCTAAAGGGAAAATGATTGTTTTCTCCAGAATTTTCTAAAATATTGTTTTGGCATTAAAAATATCTCAGGATGCTACTACTCTGCCATTAAAATATTTGTATGCATGTATTAAAAAGTATGCATGTACTTTATGAGATAAATTCTATTTCGGTTTTCAGATAACTTTATTTTTTAGTGTTCTTTTAGAGTTCAAAGAATTACAGAAGATTGAAATTAATCAATATATATAGTTAAGACTGCATGAGTTCTGAAGTTTCAAACAGTCTTTGCATTTGACAGTAAGAATCGAAATCCCTTCCATGTGCCTTTGTCAGCTAATTTATGACCAGCAGTGAAAACTTTAAAAGTATATAGGGTCTGGATGTTAAATTCTTAAATACCCTACACCAGAAATATGGAGCAGAAAAGTAACTATTTACCTATATCTTAATCACTTTGAAGATGCATGGACAGAACTCAGCTGCTTTGTTTACATATCTTACATAGACAGGTCTCTCCTATTGCCAGAGGTCCCACTGCTATCTTTGCTCACTCTTCTCTTAATATATGAATTAATATTTCTGAAAGTTCAACTTTTTAAGCCTCTAACACTTTAGGGTATTTTATGTAGATACAGTGCTTTCTTCCTCAATAGGGCTATCATTGGAACCCTTATATGTGGGAAAAGAGGAAGCAGTTGAAAAGTTCTAAGTGGAACAGAAGACAAACTTGGTTTAGTTCATACTATTTTTCATGGAGCTTTCTCTAGCTGTGGAAAAACTCAGGCTAGTAAGTATCTATTTAAAGTCTTGCAACGCAATTTTAAATAATTCATAGTTCTTACCATATTTCTAAATGCTCTTTTTCTTACCAAGCCTAATATAATTGGGAAAAAATGTCTGGATACAAATAAAACATTCTTTAGATCATGTTCAAAGCCTTATTAACATTGCACCTGAAATGACAGGCCACTCTGCCTCACTTATTTGCCAAAATGCCATTTCTAAGTTAAGGAAAATTTGAGGTAGGCTTACAGCATTCTTATTGTATTTACTTTTAGATTGTAAGCTCAATGGCAGGGGCACTATACTGATAATTATGTTTTTATATAGCAACCATTGCAGTATACTCTTGGTACTTAATAAAAATTCAGTATCCTACTGTGCATTGTTTAATTCGAATGGCTTTAAAACATATTACTATGAGAAGACAGGACTAATGTTTAAGAAAGCCCTTTTGAAAGCCACCTAGGTGGCCATCGATGGATAAGTGAATGGATAAAGAAAGCATGATGGGTAGGTAGGTAGGTAGGTGTGTGTGTGTGTGTGTGTGTGTGTGTG