Transcript asmbl_59884

Sequence
Transcript Sequence for observation asmbl_59884 of TGE0031038:
CAGGCGTGCCGGCGTCTGAGACTTCTTTGCCGCCGCCGCGGCTGCCGCGGATCTTCCCGGTGGCTTTGAGTCTCGCGCTTTCTTCGTTTGCTCGCTGGCGGGTTTGCGCCCCTCTCGCACCTTCGGGCGGTGAAGCTGGGGAAGGGGTTGGAGGGGGCTGTTGACTGCAGCCTTTAAGTTGTGCTCGGGGCGGCCATGTCGGCCGGCGAGGTTGAGCGCCTAGTGTCGGAGCTGAGCGGCGGGACCGGAGGGGATGAGGAGGAAGAGTGGCTCTATGGCGATGAAAATGAAGTTGAAAGGCCAGAAGAGGAAAATGCCAGTGCTAATCCTCCATCTGGAATTGAAGATGAAACTGCTGAAAATGGCGTACCTAAACCGAAAGTGACCGAGACTGAAGATGATAGTGATAGTGACAGTGATGATGATGAGGATGATGTTCATGTCACTATAGGAGACATTAAAACAGGAGCACCACAGTATGGGAGTTATGGTACAGCACCTGTAAATCTTAACATCAAGACAGGAGGAAGGGTTTATGGAACTACAGGAACGAAAGTCAAAGGAGTAGACCTTGATGCACCTGGAAGCATTAATGGAGTTCCACTCTTGGAGGTAGATTTGGATTCTTTTGAAGATAAACCATGGCGTAAACCTGGTGCCGATCTTTCTGATTATTTTAATTATGGGTTTAATGAAGATACCTGGAAGGCGTACTGTGAAAAACAAAAGAGGATACGAATGGGACTTGAAGTTATACCAGTTACCTCTACTACAAATAAAATTACGGTACAGCAGGGAAGAACTGGAAATTCAGAGAAGGAAACAGTGCTTCCATCTACAAAAGCTGAATTTACTTCTCCTCCTTCTTTGTTCAAGGCTGGACTCCCACCAAGCAGGAGATTACCTGGGGCAATTGATGTTATTGGTCAGACTATAACCATCAGCCGAGTAGAAGGAAGGCGACGGGCCAATGAAAACAGCAACATACAGGTTCTTTCTGAAAGATCTGCTACTGAAGTAGACAACAATTTTAGCAAACCACCTCCATTTTTCCCACCGGGAGCTCCTCCCACCCACCTGCCGCCACCACCATTTCTTCCACCTCCTCCAACTGTCAGCACTGCTCCACCTCTGATTCCACCACCAGGTATTCCAATAACTGTACCACCTCCAGGTTTTCCTCCTCCACCAGGCGCTCCACCTCCATCTCTTATACCAACAATAGAAAGTGGGCATTCCTCTGGTTATGATAGTCGTTCTGCACGTGCTTTTCCGTATGGCAATGTTGCCTTTCCCCACCTTCCTGGTTCGGCTCCTTCATGGCCTAGTCTTGTGGACACCAGCAAGCAATGGGACTATTATGCAAGAAGAGAGAAAGACCGAGACAGAGATAGAGACAGAGACCGAGAGCGAGATCGTGATCGGGACAGAGAAAGAGAACGCACCAGAGAGAGAGAGAGGGAGCGTGATCATAGTCCTACACCAAGTGTTTTCAACAGTGATGAAGAACGATACAGATATAGGGAGTATGCAGAAAGAGGTTATGAGCGTCACAGAGCAAGTCGAGAGAAAGAAGAACGACATAGAGAAAGACGACACAGAGAGAAAGAAGAAACTAGACACAAGTCATCTCGAAGTAATAGTAGACGTCGCCATGAAAGTGAAGAAGGAGACAGTCACAGGAGACACAAGCACAAAAAATCTAAAAGAAGCAAAGAAGGAAAAGAAACTGGCAGTGAGCCTGCCCCTGAACAGGAGAGCACTGAAGCTACACCTGCAGAATAGGCATGGTATAACCTTTGTGTATATTAGTGCCAGAAATAGATACTATAAATCTTGTTATTTTTCTGGA