Transcript asmbl_59870

Sequence
Transcript Sequence for observation asmbl_59870 of TGE0006898:
TAGGGCCCGTATCTGGGTGACTTCTTGGTTGCCCAGTTGCTGTCGGCTCCCCACCCCCAGCTCCTGTGCGGTCCCGCGGGCCTCCCGATTTCGGCTTGCTTTCCCCCTTTCGGGACCTCCCTCTCCGGTTCCCTCTGGGCCTTCAGCCCCTGATTGCCCGGGCTTGCCGCGCCGTCGCTCGTCGCTGTTGTCTGAGGAAAGATGAATGGGAGGGCTGATTTTCGAGAGCCGAATGCTGAAGTTGCAAGACCAATTCCCCACATAGGGGCTGATTACATTCCAACAGAGGAAGAAAGAAGAGTCTTCGCAGAATGCAATGATGAAAGTTTTTGGTTCAGATCTGTGCCTTTGGCTGCAACAAGTATGTTGATTACTCAAGGATTAATTAGTAAAGGAATCCTTTCAAGTCATCCCAAATATGGTTCCATTCCTAAACTCATATTTGCTTGTATCATGGGATACTTTGCTGGAAAGCTTTCTTATGTGAAAACGTGCCAAGAGAAGTTCAAGAATCTTGAGAATTCCCCTCTTGGAGAAGCTTTACGATCAGGACAGGCACGACGATCTTCACCACCTGGACACTACTCTCAAAAGTCAAAATATGACTCAAATGTGAGTGATCATTCATCTTTTGTGACATCACCAGCAGCAGACAACATGGAAAAAGAGATGTTTTCTCATTATGAGCCAGTTCCATTCAGTGCTTCTATGAATGAATCTACTCCCACTGGTATAACTGATCATATTGCGCAAGGTAGAAACTTCTCTTGAAATGAATTTCAGCATTTTATGGTCCAACGTATGTATAAACTTTATTTGATGACCTTTTCTGCTGGATATCACCTATATGTTCCACCATCAGTCTAAACTCAGCATGTTTGTTCATTTCTTTCTTCATTCATTTAACATTTTTTTTTCATTTACTATTTTTGAGGTCCATTAGGTATCAGGCATTCTGCTAGCTATGTTAGAAGTAAATATGAATAAGACTTGGTTCTTTTCTCTGAGAAACTCTCTGTCAGTAAATATAGAAATATAAGGATAAATTACTAGTATGTCCCATCAGTTAAATACTAACCGGGTTTAGCAGAATAGCAGAGAAGTGATAAGTGCCTCAGGGGGAGGCTTTAAAAAGTTTACATTTGTTAAGCTGATCTTAAAGGCTTTCAGCTCCTTTGCTTGTAATATGAGAAAAATACTAATTACCTGCCTTTCAAAACTGTTGTCAGGTGAGAAAATCCATGAGAAAATGCTCTGTGAAGTTTATGTAAACTCTAGCTTTGAAAATCACATAAGTAAGTGAACAATATCAACTTTGGATTAAGGCCTGGATTTGATTCATGATTGACATTTACTAGCTCTATGACTTTTGGCAAGTAACTAATTTGTGATCCCTTCAATTTCTTGATCTCTTGAATGCAGATGACAATACCTCTTTTAAAGAACTTTTGGAATGAGATGAAATAATCAGAGGTAACGCCTGGCAAGTAATAGGCTCTCAACAGACATTAGTTTCCTTCTTTTCTTCCATAAGTCTAATTTACAGTGAAAGGTGAGAAAGTATAGGTCTGCAATTTGTTACCTGAAATCCTAAAATCCAAAAAGCTTTGAAAACCGAAGTTTTTAAAAATAATTAAACAGGTGGTAAAGTCTGACCTAAACGCATTTCCAACCCTGACCTAAACTGACATAAGTTTAAATTCTGAGGAAGTCTGAATTTTGAAACATTTCTGACTCTTCAAGGATTTGGATAAGGGATTGTGGACCTCTATAGAGAATTCTTTGAAAATGCTTACTTTGAACCAAATACAATAAGCAAGCAATTAATGGGGAACAAACAGTGTTTAAAGGAACACTTTGATTTTTATTTCTTTTGTTTAAGTTGGGAGAGATTT