Transcript asmbl_59594

Sequence
Transcript Sequence for observation asmbl_59594 of TGE0006885:
CTGAAACTCCAGCGGGTGAGGATTTACTAGGAACGCATCCGTAATCCGTAGCCATCCGTTCACGGACGCGGTGGCTCTTGATCCTGGGAGCCTCGATACTCTTCTAGTGGCCGAGTAGCAGCCAAAGAGAGGGACTAAGATGCCAGTATGAAGTTCAACCCCTTTGTGACTTCTGACCGGAGCAAGAACCGTAAAAGGCATTTCAATGCACCTTCCCACATTCGCAGGAAGATTATGTCTTCTCCTCTTTCCAAAGAGCTGAGACAGAAGTACAATGTTCGATCCATGCCTATAAGAAAAGATGATGAGGTTCAGGTTGTGCGAGGACACTACAAAGGGCAGCAAATTGGCAAAGTAGTCCAGGTTTACAGGAAGAAATACGTCATCTACATTGAACGAGTGCAGCGGGAGAAGGCTAATGGCACAACTGTTCATGTCGGCATTCACCCCAGCAAGGTGGTTATCACTAGACTAAAGCTGGACAAAGACCGCAAAAAGATCCTTGAACGTAAAGCCAAATCTCGCCAAGTAGGAAAGGAAAAGGGCAAATATAAGGAAGAAACAATTGAGAAGATGCAGGAATAAAGTAATCATACACAGTTTTCATTAAAAACTTGTAAATGAA