Transcript asmbl_17862

Sequence
Transcript Sequence for observation asmbl_17862 of TGE0000465:
CTGACCCTGTCCATCAGCGTTCTATAAAGCGGCCCTCCTGGAGCCAGCCACCCAGAGCCCGCTGCCGCCGGAGCCGAGCCGACCCGCCCCGCCGACGAACCCCCTGAAGCTGTGCCAAGATGTGTGACGACGAGGAGACCACCGCCCTGGTGTGCGACAACGGCTCTGGGCTGGTGAAGGCCGGCTTTGCGGGCGATGACGCGCCCCGCGCTGTCTTCCCGTCCATCGTGGGCCGCCCGCGGCACCAGGGAGTTATGGTGGGTATGGGTCAGAAGGACTCCTACGTAGGTGATGAAGCCCAGAGCAAGAGAGGCATCCTGACCCTGAAGTATCCCATCGAGCATGGTATCATCACCAACTGGGACGACATGGAG