Transcript asmbl_5887

Sequence
Transcript Sequence for observation asmbl_5887 of TGE0028542:
CTGTTCTCCCTTTGTTCCTAGGTACTGGCTGGGATGAACATCTACCCGTCGGAATTTGAAAACATCAAGGAGGAGTACAATGTGCGTGGCTACCCCACCATCTGCTACTTCGAGAAAGGACGGTTTCTGTTCCAGTATGATAACTATGGGTCCACAGCCGAGGACATCATGGAGTGGCTGAAGAATCCGCAGCCGCCACAGCCCCAGGTCCCTGAGACTCCCTGGGCAGATGAGGGCGGCTCCGTTTATCACCTGACCGATGAAGACTTTGACCAGTTTGTGAAGGAACACTCCTCTGTCCTCGTCATGTTCCACGCCCCATGGTGTGGACACTGTAAGAAAATGAAGCCAGAGTTTGAGAGTGCAGCGGAAGTCCTCCACGGAGAAGCAGGAAGCTCTGGTGTCCTTGCAGCTGTCGATGCCACTGTCAACAAGGCCCTGGCAGAAAGATTCCACATCTCTGAGTTTCCTACATTGAAGTATTTTAAGAATGGAGAAAAATATGCAGTGCCTGTGCTCAGAACAAAGAAGAACTTTATTGAATGGATGCGAAACCCTGAGGCCCCCCCACCCCCAGAGCCCACCTGGGAAGAGCAGCAGACCAGCGTGTTGCATCTGGTGGGGGACAACTTCCGGGAGACACTGAAGAAGAAGAAACACACCTTGGTCATGTTCTATGCCCCTTGGTGCCCACACTGTAAGAAGGTTATTCCACACTTTACTGCTACTGCTGACATCTTCAAAGATGACCGCAAGATCGCCTGTGCTGCTGTGGACTGTGTCAAAGATAATAACCAGGACCTGTGTCAGCAGGAGGCCATCAAGGGCTACCCCACTTTCCACTACTACCACTATGGGAAGTTTGTAGAAAAATATGACAGCGATCGGACGGAATTGGGATTTACCAATTTTATTCGAACCCTCCGGGAGGGAGACTACGAGAGACTAGGGAAGAAGAAGGAAGAGTTGT