Transcript asmbl_5870

Sequence
Transcript Sequence for observation asmbl_5870 of TGE0006634:
AGTTATGCGGTAGGTTCCCAAGATGTCGTTCCCCAAGTACGAGCCGTCGCGCCTGGCCACCTTGCCCTCTACCCTTGACCCAGCTGAGTATGACATATCCCCGGAAACCCGGAAGGCGCAAGCCGAGCGGTTGGCCATAAGATCTCGGCTGAAAAGAGAGTACCTGCTGCAGTACAACAACCCTAGCCGCCGAGAGCTCATTGAAGATCCTGCCTTGACTCGTTGGACCTATGCAAGATCTGCAAATATCTATCCCAATTTCAGACCCACTCCCAAGACCTCACTCTTAGGAGCTGTTTTTGGATTGGGGCCCCTTTTCTTCTGGTATTATGTTTTCAAAACTGACAGAGATAGGAAAGAAAAACTTATTCGGGAAGGAAAATTGGATCGAACATTTAACATCTCATATTAATTCTGGCAATGATGACTATGTGTATTATGTTTAAATAAATCTATTAATCATTAAATAGTTTTTCTTTCTTAATGTTACCTTAATTCAATAAACATTTGCTGGACA